View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6784_low_15 (Length: 228)
Name: NF6784_low_15
Description: NF6784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6784_low_15 |
 | |
|
| [»] scaffold1183 (1 HSPs) |
| | |
|
| [»] scaffold1384 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold1183 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: scaffold1183
Description:
Target: scaffold1183; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 66 - 212
Target Start/End: Original strand, 803 - 949
Alignment:
| Q |
66 |
atcactaatttccaattccttagttgcagccttcaaatgtgctcaggatcaccaacgctgtgctaattattcttttgagaaccaacaacaatctatttta |
165 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
803 |
atcactaatttccaattccttagttgcagccttcaaatgtgctcaggatcaccaacgctgtgctaattattctattgagaaccaacaacaatctatttta |
902 |
T |
|
| Q |
166 |
gccttgaagtttgaggttgaacatttaataatctctattcttaatga |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
903 |
gccttgaagtttgaggttgaacatttaataatctctattcttaatga |
949 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1384 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: scaffold1384
Description:
Target: scaffold1384; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 74 - 205
Target Start/End: Complemental strand, 871 - 743
Alignment:
| Q |
74 |
tttccaattccttagttgcagccttcaaatgtgctcaggatcaccaacgctgtgctaattattcttttgagaaccaacaacaatctattttagccttgaa |
173 |
Q |
| |
|
||||||||||||||| ||||||||| ||| ||||||||| |||||||||| |||||| | | ||||||||||| |||||||||||||||||||||| |
|
|
| T |
871 |
tttccaattccttaggtgcagcctttaaaagtgctcagggtcaccaacgccatgctaacttta---ttgagaaccaataacaatctattttagccttgaa |
775 |
T |
|
| Q |
174 |
gtttgaggttgaacatttaataatctctattc |
205 |
Q |
| |
|
| | ||||||||||| ||||||| ||||||| |
|
|
| T |
774 |
gatcgaggttgaacaactaataatatctattc |
743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University