View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6786_low_13 (Length: 219)
Name: NF6786_low_13
Description: NF6786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6786_low_13 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 11053319 - 11053538
Alignment:
| Q |
1 |
tcagattgtggaaattcaaagacaacaataccatttcgttgtaaaatttatgacctattaaatttgcacttctaaatttcgtgtacggatttgagaatcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11053319 |
tcagattgtggaaattcaaagacaacaataccatttcgttgtaaaatttatgacctattaaatttgcacttctaaatttcgtgtacggatttgagaatcc |
11053418 |
T |
|
| Q |
101 |
acaaattcatgggcgcttcacctacttaacacagctaa-taggnnnnnnnattatggatgcttgtaggaaaggatgactatagacgcagcttctctctct |
199 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11053419 |
gcaaattcatgtgcgcttcacctacttaacacagctaaataggctcccccattatggatgcttgtaggaaaggatgactatagacgcagcttctctctct |
11053518 |
T |
|
| Q |
200 |
tagggatccaataaataaat |
219 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
11053519 |
tagggatccaataaataaat |
11053538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University