View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6786_low_7 (Length: 379)
Name: NF6786_low_7
Description: NF6786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6786_low_7 |
 |  |
|
| [»] chr3 (6 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 206; Significance: 1e-112; HSPs: 6)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 141 - 379
Target Start/End: Complemental strand, 7718731 - 7718493
Alignment:
| Q |
141 |
gaaattttttccgcgaaagtgaaaagtagnnnnnnntttagaagtttcgttgccgaaatccgagagttttttggaaatggatatggaatttgagacatta |
240 |
Q |
| |
|
||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7718731 |
gaaatttttgccgcgaaagtgaaaagtagaaaaaaatttagaagtttcgttgccgaaatccgagagttttttggaaatggatatggaatttgagacatta |
7718632 |
T |
 |
| Q |
241 |
ctggattttgcttttaatgctttaagtttctctgtgaaatttattgaatgatttaagaaaattctcagttttgttactgaaattgtcgagtttttgtgca |
340 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7718631 |
ctggattttgcttttaatgctttaagtttgtctgtgaaatttattgaatgatttaagaaaattctcagttttgttactgaaattgtcgagtttttgtgca |
7718532 |
T |
 |
| Q |
341 |
actggatatggaatttgagatgatactgaattttgattt |
379 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
7718531 |
actggatatggagtttgagatgatactgaattttgattt |
7718493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 177 - 256
Target Start/End: Complemental strand, 7718865 - 7718786
Alignment:
| Q |
177 |
tttagaagtttcgttgccgaaatccgagagttttttggaaatggatatggaatttgagacattactggattttgctttta |
256 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||| ||| ||||||||| ||||| |
|
|
| T |
7718865 |
tttagaagttttgttgctgaaatccgagagttttttggaaatggatatggaatttgagatgttagtggattttgatttta |
7718786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 7719053 - 7719011
Alignment:
| Q |
1 |
aaaatggaaagggaaattagaagtttcgttgctgaaattttgg |
43 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7719053 |
aaaatggaaagggaaattagaagtttcgttgctgaaattttgg |
7719011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 256 - 305
Target Start/End: Complemental strand, 7718943 - 7718894
Alignment:
| Q |
256 |
aatgctttaagtttctctgtgaaatttattgaatgatttaagaaaattct |
305 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||||| |||||||||| |
|
|
| T |
7718943 |
aatgctttaagtttgtttgtgaaatttattgaatgattcgagaaaattct |
7718894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 256 - 300
Target Start/End: Complemental strand, 7718772 - 7718728
Alignment:
| Q |
256 |
aatgctttaagtttctctgtgaaatttattgaatgatttaagaaa |
300 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||||||| ||||| |
|
|
| T |
7718772 |
aatgctttaagtttgtttgtgaaatttattgaatgatttgagaaa |
7718728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 256 - 306
Target Start/End: Complemental strand, 7719114 - 7719064
Alignment:
| Q |
256 |
aatgctttaagtttctctgtgaaatttattgaatgatttaagaaaattctc |
306 |
Q |
| |
|
||||||| |||||||| | || ||||||||||||||||| ||||||||||| |
|
|
| T |
7719114 |
aatgcttgaagtttctttctgcaatttattgaatgatttgagaaaattctc |
7719064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University