View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6789_high_13 (Length: 208)

Name: NF6789_high_13
Description: NF6789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6789_high_13
NF6789_high_13
[»] chr2 (1 HSPs)
chr2 (22-121)||(37327726-37327823)


Alignment Details
Target: chr2 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 22 - 121
Target Start/End: Original strand, 37327726 - 37327823
Alignment:
22 gatgatagttcacaaatttactcaatgtagacatatttgttttgtcttttcaccgaaatgtgaacatttttaaaaacttctatagttttaacattttcaa 121  Q
    |||||||||||||||||||||||||||||||||||||||||  ||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||    
37327726 gatgatagttcacaaatttactcaatgtagacatatttgtt--gtcttttgaccgaaatgtgaacatttttataaacttctatagttttaacattttcaa 37327823  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University