View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6789_high_14 (Length: 206)
Name: NF6789_high_14
Description: NF6789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6789_high_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 12 - 193
Target Start/End: Complemental strand, 30019230 - 30019055
Alignment:
| Q |
12 |
gagttttgtgaatcatttacattcacagttgcagcagctgcagcagtattaacctcattagcttttctttgttcttgttcagctctccatgtcctcaact |
111 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| || |||| | ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30019230 |
gagtttggtgaatcatttacattcacagttgcagcagcagctgcagcag------cattagcttttctttgttcttgttcagctctccatgtcctcaact |
30019137 |
T |
 |
| Q |
112 |
cttgttctacagctgattttccttctgcagctttctcagcattctcatttgcaatcttaagtgattcctttcttacacacag |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
30019136 |
cttgttctacagctgattttccttctgcagctttctcagcattctcatttgcaatcttaagtgattcccttcttacacacag |
30019055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University