View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6789_low_10 (Length: 423)
Name: NF6789_low_10
Description: NF6789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6789_low_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 362; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 362; E-Value: 0
Query Start/End: Original strand, 1 - 413
Target Start/End: Original strand, 9339990 - 9340403
Alignment:
| Q |
1 |
tttgaagttcatttatggtgtgtcagcctgtttattattgcttatgttgtgtt-tgttctaaaaaataaacatatttctattagtattgtatggccactg |
99 |
Q |
| |
|
||||||||||||||||||||||| || || |||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9339990 |
tttgaagttcatttatggtgtgttggcttgcttattattgcttatgtcgtcacctgttctaaaaaataaacatatttctattagtattgtatggccactg |
9340089 |
T |
|
| Q |
100 |
ctagtaagacttaatttacgatgctgtaaatgtcttccgactcactattcaaatcacaattaaatgaccttaatttttgtctttatttgttatgtgtaca |
199 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9340090 |
ctagtaagacttaatttacgacgctgtaaatgtcttccgactcactattcaaatcacaattaaatgaccttaatttttgtctttatttgttatgtgtaca |
9340189 |
T |
|
| Q |
200 |
tcatttctactttatgcttaattatttgttcatttgtagggaccacaatgtcaaaattggctggaagcaacaacggcaaccctttgatgaggcctgtgga |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9340190 |
tcatttctactttatgcttaattatttgttcatttgtagggaccacaatgtcaaaattggctggaagcaacaacggcaaccctttgatgaggcctgtgga |
9340289 |
T |
|
| Q |
300 |
tcccaatgctgcatattcccatcatacaggaaaacctgttgcaaatgaagctattgggagtgacactcataatagtgaggcagataagttacatcccttt |
399 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9340290 |
agccaatgctgcatattcccatcatacaggaaaacctgttgcaaatgaagctattgggagtgacactcataatagtgaggcagataagttacatcccttt |
9340389 |
T |
|
| Q |
400 |
ggtttattgatgtc |
413 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
9340390 |
ggtttattgatgtc |
9340403 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University