View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6789_low_21 (Length: 236)
Name: NF6789_low_21
Description: NF6789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6789_low_21 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 15 - 220
Target Start/End: Original strand, 28250104 - 28250309
Alignment:
| Q |
15 |
gacatcacgaggaggtcgtcgacggtaacgtgttcgaggattgccgagattcgtttctcgagttcggttttgcagacggtggaggcgcggaggtggatgg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28250104 |
gacatcacgaggaggtcgtcgacggtaacgtgttcgaggattgccgagattcgtttctcgagttcggttttgcagacggtggaggcgcggaggtggatgg |
28250203 |
T |
|
| Q |
115 |
cgcaacggaggaggcagcaaaggaagttgattggaaaagctgctttctctgaagggaagagattgataattaactgtagaaggcttcgttgttttgatct |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
28250204 |
cgcaacggaggaggcagcaaaggaagttgattggaaaagctgctttctccgaagggaagagattgataattaactctagaaggcttcgttgttttgatct |
28250303 |
T |
|
| Q |
215 |
gatgtc |
220 |
Q |
| |
|
|||||| |
|
|
| T |
28250304 |
gatgtc |
28250309 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 63 - 176
Target Start/End: Original strand, 32179733 - 32179846
Alignment:
| Q |
63 |
attcgtttctcgagttcggttttgcagacggtggaggcgcggaggtggatggcgcaacggaggaggcagcaaaggaagttgattggaaaagctgctttct |
162 |
Q |
| |
|
||||| |||||||||||| ||||| || | |||||||| |||| ||| || |||||||| || ||||| ||||||||||| |||||||| ||||||| |
|
|
| T |
32179733 |
attcgcttctcgagttcgcgcttgcacgcgcttgaggcgcgtaggtagatagcacaacggagaagacagcagaggaagttgatcggaaaagcagctttct |
32179832 |
T |
|
| Q |
163 |
ctgaagggaagaga |
176 |
Q |
| |
|
| || || |||||| |
|
|
| T |
32179833 |
ccgacggaaagaga |
32179846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University