View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6789_low_23 (Length: 208)
Name: NF6789_low_23
Description: NF6789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6789_low_23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 22 - 121
Target Start/End: Original strand, 37327726 - 37327823
Alignment:
| Q |
22 |
gatgatagttcacaaatttactcaatgtagacatatttgttttgtcttttcaccgaaatgtgaacatttttaaaaacttctatagttttaacattttcaa |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
37327726 |
gatgatagttcacaaatttactcaatgtagacatatttgtt--gtcttttgaccgaaatgtgaacatttttataaacttctatagttttaacattttcaa |
37327823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University