View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6789_low_5 (Length: 474)
Name: NF6789_low_5
Description: NF6789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6789_low_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 360; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 360; E-Value: 0
Query Start/End: Original strand, 20 - 413
Target Start/End: Original strand, 9339592 - 9339982
Alignment:
| Q |
20 |
gggatcgacttgcctgttcgctcgtcagatgccccagaaggatctccttttcaagaacttggtgacgttatgcctcatctgagagttaacacagggttag |
119 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
9339592 |
gggatcgacttgcttgttcgctcttcagatgccccagaaggatctccttttcaagaacttggtgacattatgcctcatctgagagttaacacagggttag |
9339691 |
T |
|
| Q |
120 |
gttctgatagtaacatggttaatcagtcagaaccatctgatgccattggaagaaacctaaaagttgatgtaaattcatttgactataatgggtcttcttt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9339692 |
gttctgatagtaacatggttaatcagtcagaaccatctgatgccattggaagaaacctaaaagttgatgtaaattcatttgactataatgggtcttcttt |
9339791 |
T |
|
| Q |
220 |
tgctgacgatcaaccatggtcttcatcccgacccggttctacatccagtgttggtattccatcccaaacacctaatcgaagttatcaccctgaaatcaag |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9339792 |
tgctgacgatcaaccatggtcttcatcccgacccggttctacatccagtgttggtattccttcccaaacacctaatcgaagttatcaccctgaaatcaag |
9339891 |
T |
|
| Q |
320 |
ttctctgatgagcagtacttcaataatattgttgcacaagatgagggtaagtaattgttttctcattttattattattattatcatctacttat |
413 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
9339892 |
ttctctgatgagcagtacttcaataatattggtgcacaagatgagggtaagtaattgttttctcattttat---tattattatcatctacttat |
9339982 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University