View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6790_high_13 (Length: 258)
Name: NF6790_high_13
Description: NF6790
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6790_high_13 |
 |  |
|
| [»] scaffold0055 (1 HSPs) |
 |  |  |
|
| [»] scaffold0052 (1 HSPs) |
 |  |  |
|
| [»] scaffold0331 (1 HSPs) |
 |  |  |
|
| [»] scaffold0164 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0055 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: scaffold0055
Description:
Target: scaffold0055; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 12 - 194
Target Start/End: Complemental strand, 282 - 100
Alignment:
| Q |
12 |
tcaatcacaaattcttcatctctcactcaatctatttcatttcctctcaccctcaatctttgaaaccctaaaacgcaatctcctctctcacaccctctgt |
111 |
Q |
| |
|
|||||| |||| |||||||||| | || ||||| ||||||||||||||||||||||||||||||||||||||| ||||| |||| |||||||||||| || |
|
|
| T |
282 |
tcaatctcaaaatcttcatctcaccctaaatctctttcatttcctctcaccctcaatctttgaaaccctaaaaagcaatttcctttctcacaccctccgt |
183 |
T |
 |
| Q |
112 |
tctccaacagccacgcctccgtgcttctccgccaaccacaccgctgagcctcaatcttgttcaaccgatcatcattctcaaat |
194 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||||||||| || |||| ||||||||||||||||||||| | ||||||||| |
|
|
| T |
182 |
tctccaccagccacgccgccgtgcttctccgccaaccacactgccgagcttcaatcttgttcaaccgatcacctttctcaaat |
100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0052 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: scaffold0052
Description:
Target: scaffold0052; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 12 - 194
Target Start/End: Original strand, 84253 - 84435
Alignment:
| Q |
12 |
tcaatcacaaattcttcatctctcactcaatctatttcatttcctctcaccctcaatctttgaaaccctaaaacgcaatctcctctctcacaccctctgt |
111 |
Q |
| |
|
|||||| |||| |||||||||| | || ||||| ||||||||||||||||||||||||||||||||||||||| ||||| |||| |||||||||||| || |
|
|
| T |
84253 |
tcaatctcaaaatcttcatctcaccctaaatctctttcatttcctctcaccctcaatctttgaaaccctaaaaagcaatttcctttctcacaccctccgt |
84352 |
T |
 |
| Q |
112 |
tctccaacagccacgcctccgtgcttctccgccaaccacaccgctgagcctcaatcttgttcaaccgatcatcattctcaaat |
194 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||||||||| || |||| ||||||||||||||||||||| | ||||||||| |
|
|
| T |
84353 |
tctccaccagccacgccgccgtgcttctccgccaaccacactgccgagcttcaatcttgttcaaccgatcacctttctcaaat |
84435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 12 - 194
Target Start/End: Complemental strand, 7206386 - 7206204
Alignment:
| Q |
12 |
tcaatcacaaattcttcatctctcactcaatctatttcatttcctctcaccctcaatctttgaaaccctaaaacgcaatctcctctctcacaccctctgt |
111 |
Q |
| |
|
|||||| |||| |||||||||| | || ||||| ||||||||||||||||||||||||||||||||||||||| ||||| |||| |||||||||||| || |
|
|
| T |
7206386 |
tcaatctcaaaatcttcatctcaccctaaatctctttcatttcctctcaccctcaatctttgaaaccctaaaaagcaatttcctttctcacaccctccgt |
7206287 |
T |
 |
| Q |
112 |
tctccaacagccacgcctccgtgcttctccgccaaccacaccgctgagcctcaatcttgttcaaccgatcatcattctcaaat |
194 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||||||||| || |||| ||||||||||||||||||||| | ||||||||| |
|
|
| T |
7206286 |
tctccaccagccacgccgccgtgcttctccgccaaccacactgccgagcttcaatcttgttcaaccgatcacctttctcaaat |
7206204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 201 - 246
Target Start/End: Complemental strand, 7205925 - 7205880
Alignment:
| Q |
201 |
ttgttgggtctttgcttgacaatgtttaagtgtaaaattgtgatgt |
246 |
Q |
| |
|
||||||||||||||||| | ||||||||||||||||| | |||||| |
|
|
| T |
7205925 |
ttgttgggtctttgcttaataatgtttaagtgtaaaactatgatgt |
7205880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 82; Significance: 8e-39; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 37 - 182
Target Start/End: Original strand, 48009158 - 48009303
Alignment:
| Q |
37 |
ctcaatctatttcatttcctctcaccctcaatctttgaaaccctaaaacgcaatctcctctctcacaccctctgttctccaacagccacgcctccgtgct |
136 |
Q |
| |
|
|||||| | ||||||||||| ||||||| ||||| ||||||||||||| |||||||||||||||||||||| |||||||| | |||||| | |||||| |
|
|
| T |
48009158 |
ctcaatatctttcatttcctttcacccttaatctatgaaaccctaaaaagcaatctcctctctcacacccttcgttctccaccggccacgtcgtcgtgct |
48009257 |
T |
 |
| Q |
137 |
tctccgccaaccacaccgctgagcctcaatcttgttcaaccgatca |
182 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||||||| |||||| |
|
|
| T |
48009258 |
tctccgccaacctcaccgccgagcctcaatcttgttcaatcgatca |
48009303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 201 - 246
Target Start/End: Original strand, 48009614 - 48009659
Alignment:
| Q |
201 |
ttgttgggtctttgcttgacaatgtttaagtgtaaaattgtgatgt |
246 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
48009614 |
ttgttgggtctttgcttaataatgtttaagtgtaaaattgtgatgt |
48009659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0331 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: scaffold0331
Description:
Target: scaffold0331; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 201 - 246
Target Start/End: Original strand, 688 - 733
Alignment:
| Q |
201 |
ttgttgggtctttgcttgacaatgtttaagtgtaaaattgtgatgt |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
688 |
ttgttgggtctttgcttgacaatgtttaagtgtaaaattgtgatgt |
733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0164 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: scaffold0164
Description:
Target: scaffold0164; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 201 - 246
Target Start/End: Complemental strand, 22456 - 22411
Alignment:
| Q |
201 |
ttgttgggtctttgcttgacaatgtttaagtgtaaaattgtgatgt |
246 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
22456 |
ttgttgggtctttgcttgataatgtttaagtgtaaaattgtgatgt |
22411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University