View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6790_high_14 (Length: 234)
Name: NF6790_high_14
Description: NF6790
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6790_high_14 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 14 - 234
Target Start/End: Original strand, 55377358 - 55377587
Alignment:
| Q |
14 |
atcaaggagtgccgttgaagaagacaaaatacagtgtcttgttgtagttgttttgggtgctgcatcaaaaagaaaagagtgaggtgagaaatgagnnnnn |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55377358 |
atcaaggagtgccgttgaagaagacaaaatacagtgtcttgttgtagttgttttgggtgctgcatcaaaaagaaaagagtgaggtgagaaatgagaatat |
55377457 |
T |
 |
| Q |
114 |
nnnnnnnnnnnnnngagaattgtttatgcatacactgaagaagaaaga---------gatgatgatgatgatggcggtgggtagggatcctgatgaaagt |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
55377458 |
aatataatataatagagaattgtttatgcatacactgaagaagaaagagatgatgatgatgatgatgatgatgccggtgggtagggattctgatgaaagt |
55377557 |
T |
 |
| Q |
205 |
gtctgggttgcagatgaattgtggcaataa |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
55377558 |
gtctgggttgcagatgaattgtggcaataa |
55377587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University