View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6790_high_7 (Length: 354)
Name: NF6790_high_7
Description: NF6790
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6790_high_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 110; Significance: 2e-55; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 50 - 196
Target Start/End: Complemental strand, 3003403 - 3003254
Alignment:
| Q |
50 |
atattgtcatttattataggagagagatctcaactccttaaaatgtacatgttgcgttactctggtatttcaaatgtaatattgggaatgttttatctat |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||| |||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
3003403 |
atattgtcatttattataggagagagatctcaactccttagaatgtacatgtggcgttac-ctggtatttcaaatgtaatattaggaatgttttatctat |
3003305 |
T |
|
| Q |
150 |
gtgt----aagaggatacaaagttacaatatatattgttcaaacattgtga |
196 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3003304 |
gtgcgtgcaagaggatacaaagttacaatatatattgttcaaacattgtga |
3003254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 106; E-Value: 5e-53
Query Start/End: Original strand, 214 - 335
Target Start/End: Complemental strand, 3003046 - 3002925
Alignment:
| Q |
214 |
cggtgattggagtttgagtttcacggtggtttcatgggggatttgggtttcgcggtgggattagatttcacaatgactggagtttaagtttcacggtggt |
313 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||| |||||||| |||||||||||||| |
|
|
| T |
3003046 |
cggtgattggagtttgagtttcacggtggtttcatggaggatttgggtttcgcggtgggattaggtttcacaatgagtggagtttgagtttcacggtggt |
3002947 |
T |
|
| Q |
314 |
tcgatcgagaaatggaggatgg |
335 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
3002946 |
tcgatcgagaaatggaggatgg |
3002925 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 3003469 - 3003424
Alignment:
| Q |
1 |
agatgatcttaactcatttaaaataatatatcacattaattgaattata |
49 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
3003469 |
agatgatcttaactcatttaaaata---tatcacattaattgaattata |
3003424 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University