View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6790_low_12 (Length: 352)
Name: NF6790_low_12
Description: NF6790
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6790_low_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 67; Significance: 1e-29; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 16 - 121
Target Start/End: Complemental strand, 4941282 - 4941176
Alignment:
| Q |
16 |
aagaagaaatgcaaatttc-gttacgtttattccaaatactttctatcatagttctattggtgattagaagttactttcatcatattgagagaaggatcc |
114 |
Q |
| |
|
|||||||||| |||||||| |||| ||| |||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
4941282 |
aagaagaaatacaaatttctgttaattttgatccaaataaattctatcatagttctattggtggttagaagttactttcatcatattgagagaaggatcc |
4941183 |
T |
|
| Q |
115 |
aagaaat |
121 |
Q |
| |
|
||||||| |
|
|
| T |
4941182 |
aagaaat |
4941176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 16 - 99
Target Start/End: Complemental strand, 4918411 - 4918328
Alignment:
| Q |
16 |
aagaagaaatgcaaatttcgttacgtttattccaaatactttctatcatagttctattggtgattagaagttactttcatcata |
99 |
Q |
| |
|
||||||||||||||||||| |||| ||| || |||||| |||||||||||||||| ||||| | |||||| |||||||||||| |
|
|
| T |
4918411 |
aagaagaaatgcaaatttcattacttttgatctaaatacattctatcatagttctaatggtggtgagaagtcactttcatcata |
4918328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University