View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6791_low_8 (Length: 292)
Name: NF6791_low_8
Description: NF6791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6791_low_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 263; Significance: 1e-147; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 263; E-Value: 1e-147
Query Start/End: Original strand, 5 - 283
Target Start/End: Complemental strand, 28161794 - 28161516
Alignment:
| Q |
5 |
gagatggacatcaaagctgtatacatcggcaggttgagtttgtggccgttgaaaactgcggcactcgggggctctatagaaaaaagaagtggcacttggt |
104 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
28161794 |
gagaaggacaccaaagctgtatacatcggcaggttgagtttgtggccgttgaaaactgcggcactcgggtgctctatagaaaaaagaagtggcacttggt |
28161695 |
T |
|
| Q |
105 |
tcctccattgtgtcgggattaaggaacacagtgagaccataatcagtgagacaggactcaaagtcggcaccaagtaacacattggaagatttcagatttc |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28161694 |
tcctccattgtgtcgggattaaggaacacagtgagaccataatcagtgagacaggactcaaagtcggcaccaagtaacacattggaagatttcagatttc |
28161595 |
T |
|
| Q |
205 |
cgtgagccatgccggggttttggtggatatagagaaggcctgttgctagatcttctgcaattttaagacatgatgtcca |
283 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28161594 |
catgagccatgccggggttttggtggatatagagaaggcctgttgctagatcttctgcaattttaagacatgatgtcca |
28161516 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University