View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6792_high_19 (Length: 212)

Name: NF6792_high_19
Description: NF6792
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6792_high_19
NF6792_high_19
[»] chr7 (1 HSPs)
chr7 (145-190)||(35451305-35451350)


Alignment Details
Target: chr7 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 145 - 190
Target Start/End: Complemental strand, 35451350 - 35451305
Alignment:
145 tgttaggcttaagtttgttggggctttcttatacactgtactatat 190  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
35451350 tgttaggcttaagtttgttggggctttcttatacactgtactatat 35451305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University