View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6792_low_15 (Length: 392)

Name: NF6792_low_15
Description: NF6792
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6792_low_15
NF6792_low_15
[»] chr8 (1 HSPs)
chr8 (17-100)||(8165204-8165287)
[»] scaffold0625 (1 HSPs)
scaffold0625 (91-159)||(8992-9060)
[»] chr7 (2 HSPs)
chr7 (91-159)||(18960691-18960759)
chr7 (91-159)||(18992648-18992716)
[»] chr4 (1 HSPs)
chr4 (91-162)||(55459867-55459938)
[»] chr3 (1 HSPs)
chr3 (91-162)||(13226575-13226646)
[»] chr5 (1 HSPs)
chr5 (91-149)||(21291633-21291691)


Alignment Details
Target: chr8 (Bit Score: 68; Significance: 3e-30; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 17 - 100
Target Start/End: Complemental strand, 8165287 - 8165204
Alignment:
Q  17 gattctggtggaggaaggttagtctgccataatgattcatacgctgaagcagtagaaaaaccacaatcactttttccccacttt 100  Q
    |||||| |||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
T  8165287 gattcttgtggagaaaggttagtccgccataatgattcatacgctgaagcagtagaaaaaccacaatcactgtttccccacttt 8165204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0625 (Bit Score: 49; Significance: 6e-19; HSPs: 1)
Name: scaffold0625
Description:

Target: scaffold0625; HSP #1
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 91 - 159
Target Start/End: Original strand, 8992 - 9060
Alignment:
Q  91 tccccactttcgtgctttggtgggtcttcgagatactttagatgacctatcttggaaagatatctatct 159  Q
    ||||| |||||||||||||||||||||||||||| |||| |||||||||| ||| ||||||||||||||    
T  8992 tccccgctttcgtgctttggtgggtcttcgagatgctttcgatgacctatgttgaaaagatatctatct 9060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 49; Significance: 6e-19; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 91 - 159
Target Start/End: Complemental strand, 18960759 - 18960691
Alignment:
Q  91 tccccactttcgtgctttggtgggtcttcgagatactttagatgacctatcttggaaagatatctatct 159  Q
    ||||| |||||||||||||||||||||||||||| |||| |||||||||| ||| ||||||||||||||    
T  18960759 tccccgctttcgtgctttggtgggtcttcgagatgctttcgatgacctatgttgaaaagatatctatct 18960691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 91 - 159
Target Start/End: Complemental strand, 18992716 - 18992648
Alignment:
Q  91 tccccactttcgtgctttggtgggtcttcgagatactttagatgacctatcttggaaagatatctatct 159  Q
    ||||| |||||||||||||||||||||||||||| |||| |||||||||| ||| ||||||||||||||    
T  18992716 tccccgctttcgtgctttggtgggtcttcgagatgctttcgatgacctatgttgaaaagatatctatct 18992648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 91 - 162
Target Start/End: Complemental strand, 55459938 - 55459867
Alignment:
Q  91 tccccactttcgtgctttggtgggtcttcgagatactttagatgacctatcttggaaagatatctatctata 162  Q
    ||||| |||||||||||||||||||||||||||| |||| |||||| ||| ||| |||||||||||||||||    
T  55459938 tccccgctttcgtgctttggtgggtcttcgagatgctttcgatgacttatgttgaaaagatatctatctata 55459867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 91 - 162
Target Start/End: Complemental strand, 13226646 - 13226575
Alignment:
Q  91 tccccactttcgtgctttggtgggtcttcgagatactttagatgacctatcttggaaagatatctatctata 162  Q
    ||||| |||||||||||||||||||||||||||| |||| |||||| ||| ||| |||||||||||||||||    
T  13226646 tccccgctttcgtgctttggtgggtcttcgagatgctttcgatgacttatgttgaaaagatatctatctata 13226575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 91 - 149
Target Start/End: Original strand, 21291633 - 21291691
Alignment:
Q  91 tccccactttcgtgctttggtgggtcttcgagatactttagatgacctatcttggaaag 149  Q
    ||||| |||||||||||||||||||||||||||| |||| |||||||||| ||| ||||    
T  21291633 tccccgctttcgtgctttggtgggtcttcgagatgctttcgatgacctatgttgaaaag 21291691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University