View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6792_low_23 (Length: 333)
Name: NF6792_low_23
Description: NF6792
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6792_low_23 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 155; Significance: 3e-82; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 15 - 188
Target Start/End: Original strand, 30471998 - 30472172
Alignment:
| Q |
15 |
catcactcaattgatcctaatatgtccaatttaattaccttcatccatccttaaatataaaacctccatccatcgatttgtggtttttgtggacggg-tt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| || |
|
|
| T |
30471998 |
catcactcaattgatcctaatatgtccaatttaattaccttcatccatccttaaatataaaaccaccatccatcgatttgtggtttttgtggacgggttt |
30472097 |
T |
|
| Q |
114 |
tcgttcgagtagcagaagataagtgtttggatctcgtttggagatttgcaatggtggttgaagatttggctcaca |
188 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30472098 |
tcgttcgagtagtggaagataagtgtttggatctcgtttggagatttgcaatggtggttgaagatttggctcaca |
30472172 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 286 - 320
Target Start/End: Original strand, 30472270 - 30472304
Alignment:
| Q |
286 |
agttgagtgatatttttgtcagtgatttgatgtcc |
320 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |
|
|
| T |
30472270 |
agttgagtgatatttttgtcggtgatttgatgtcc |
30472304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University