View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6792_low_25 (Length: 320)
Name: NF6792_low_25
Description: NF6792
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6792_low_25 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 95 - 303
Target Start/End: Original strand, 26398914 - 26399119
Alignment:
| Q |
95 |
aaatcaatctcgatatattattattacttacaatatatttttatgagtgaaaaagtagttttgagttaagaatatcgtcgagatactaattattgtattt |
194 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26398914 |
aaatcaatctcgatatatt---attacttacaatatatttttatgagtgaagaagtagttttgagttaagaatatcgtcgagatactaattattgtattt |
26399010 |
T |
 |
| Q |
195 |
cagaaagcttttagaccgtgtctaacaacatttagcgatgaacaaaatctcttccataagcaatcgtacgttatacaagataaattacttgaagacaata |
294 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26399011 |
cagaaagcttttagaccgtgtttaacaacatttagcgatgaacaaaatctcttccataagcaatcgtacgttatacaagataaattacttgaagacaata |
26399110 |
T |
 |
| Q |
295 |
attagtcat |
303 |
Q |
| |
|
||||||||| |
|
|
| T |
26399111 |
attagtcat |
26399119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University