View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6792_low_28 (Length: 286)
Name: NF6792_low_28
Description: NF6792
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6792_low_28 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 9 - 249
Target Start/End: Complemental strand, 3467792 - 3467552
Alignment:
| Q |
9 |
gagatggacatccatgggaggagaagatgagatggaactgatcaaagacttacctgagggtttgaggagagacatcaagcgccatctttgcttggacctc |
108 |
Q |
| |
|
||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3467792 |
gagatgggcagccatgggaggagaagatgagatggaactgatcaaagacttacctgagggtttgaggagagacatcaagcgccatctttgcttggacctc |
3467693 |
T |
|
| Q |
109 |
attaaaaaggtaagaaagattcaaacctgcaaatgaaacaaattggaccgtaaagttgccccaagaagaaggataaatttcctaagttgttagattaaga |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3467692 |
attaaaaaggtaagaaagattcaaacctgcaaatgaaacaaattagaccgtaaagttgccccaagaagaaggataaatttcctaagttgttagattaaga |
3467593 |
T |
|
| Q |
209 |
aagataaaggaaagaagcttataaaattatctttcttttga |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3467592 |
aagataaaggaaagaagcttataaaattatctttcttttga |
3467552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University