View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6792_low_29 (Length: 274)
Name: NF6792_low_29
Description: NF6792
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6792_low_29 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 169; Significance: 1e-90; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 83 - 251
Target Start/End: Complemental strand, 4264443 - 4264275
Alignment:
| Q |
83 |
ttttggagggattagtttttgcttcggtacaaaaatttaagaaacacatcggagggtggtggttactctgccctgctccaaatgaacattctcatagtta |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4264443 |
ttttggagggattagtttttgcttcggtacaaaaatttaagaaacacatcggagggtggtggttactctgccctgctccaaatgaacattctcatagtta |
4264344 |
T |
|
| Q |
183 |
tctccgcttcaatctctctacttctagccatactcattgcttctctccatcttctccaccccacatgta |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4264343 |
tctccgcttcaatctctctacttctagccatactcattgcttctctccatcttctccaccccacatgta |
4264275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 38 - 93
Target Start/End: Complemental strand, 4271407 - 4271352
Alignment:
| Q |
38 |
atttgccatatacctagaaatggggatgcattaattaaatacattttttggaggga |
93 |
Q |
| |
|
||||||||||| |||||||||||| ||||| | ||||||||| |||||||||||| |
|
|
| T |
4271407 |
atttgccatatccctagaaatgggaatgcagcagttaaatacagtttttggaggga |
4271352 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University