View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6792_low_35 (Length: 230)
Name: NF6792_low_35
Description: NF6792
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6792_low_35 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 32214540 - 32214760
Alignment:
| Q |
1 |
ttggtggattggatcgtgatactacagaggaagatctgaaaaagatttttcagaggattggggaggtactggaagtcaggttgcacaaaaattcttcaac |
100 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
32214540 |
ttggtggattggatcgtgatactaccgaggaagatctgaaaaagatttttcagaggattggggaggtactggaagtcaggttgcataaaaattcttcaac |
32214639 |
T |
|
| Q |
101 |
aagtaaaaataggggctatgctgttgtgaggtttgctaataaggatcatgcaaagaaagctttgtctgaaatgaagaaccctgttgtatgtttctgttct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32214640 |
aagtaaaaataggggctatgctgttgtgaggtttgctaataaggagcatgcaaagaaagctttgtctgaaatgaagaaccctgttgtatgtttctgttct |
32214739 |
T |
|
| Q |
201 |
tattcttaatttccttgatgt |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
32214740 |
tattcttaatttccttgatgt |
32214760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 131 - 180
Target Start/End: Original strand, 19331344 - 19331393
Alignment:
| Q |
131 |
gtttgctaataaggatcatgcaaagaaagctttgtctgaaatgaagaacc |
180 |
Q |
| |
|
||||| ||||||| | |||| |||||||||||||||| |||||||||||| |
|
|
| T |
19331344 |
gtttgataataagaaacatgaaaagaaagctttgtctaaaatgaagaacc |
19331393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University