View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6792_low_40 (Length: 208)
Name: NF6792_low_40
Description: NF6792
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6792_low_40 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 66 - 192
Target Start/End: Original strand, 8187863 - 8187989
Alignment:
| Q |
66 |
tgcagactttaatcctttgtttctaaaggaaacactttcggatgcttcatcaagtttgagttctgaaggtgatggattggatcgtaatgttgtagatagt |
165 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8187863 |
tgcagactttaatcctttgtttctaaaggaaacactttcagatgcttcatcaagtttgagttctgaaggtgatggattggatcgtaatgttgtagatagt |
8187962 |
T |
 |
| Q |
166 |
gggccatctatggatatagatttggaa |
192 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
8187963 |
gggccatctatggatatagatttggaa |
8187989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University