View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6792_low_7 (Length: 486)
Name: NF6792_low_7
Description: NF6792
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6792_low_7 |
 |  |
|
| [»] chr1 (252 HSPs) |
 |  |
|
| [»] scaffold0370 (1 HSPs) |
 |  |  |
|
| [»] scaffold0326 (4 HSPs) |
 |  |  |
|
| [»] scaffold0811 (2 HSPs) |
 |  |  |
|
| [»] scaffold0337 (1 HSPs) |
 |  |  |
|
| [»] scaffold0210 (2 HSPs) |
 |  |  |
|
| [»] scaffold0051 (2 HSPs) |
 |  |  |
|
| [»] scaffold0373 (1 HSPs) |
 |  |  |
|
| [»] scaffold0065 (2 HSPs) |
 |  |  |
|
| [»] scaffold1001 (1 HSPs) |
 |  |  |
|
| [»] scaffold0179 (1 HSPs) |
 |  |  |
|
| [»] scaffold0166 (2 HSPs) |
 |  |  |
|
| [»] scaffold0003 (2 HSPs) |
 |  |  |
|
| [»] scaffold0159 (1 HSPs) |
 |  |  |
|
| [»] scaffold0060 (2 HSPs) |
 |  |  |
|
| [»] scaffold0021 (2 HSPs) |
 |  |  |
|
| [»] scaffold0535 (2 HSPs) |
 |  |  |
|
| [»] scaffold0347 (2 HSPs) |
 |  |  |
|
| [»] scaffold0160 (3 HSPs) |
 |  |  |
|
| [»] scaffold0005 (5 HSPs) |
 |  |  |
|
| [»] scaffold0001 (3 HSPs) |
 |  |  |
|
| [»] scaffold0712 (1 HSPs) |
 |  |  |
|
| [»] scaffold0709 (1 HSPs) |
 |  |  |
|
| [»] scaffold0016 (2 HSPs) |
 |  |  |
|
| [»] scaffold0056 (3 HSPs) |
 |  |  |
|
| [»] scaffold0026 (2 HSPs) |
 |  |  |
|
| [»] scaffold0024 (2 HSPs) |
 |  |  |
|
| [»] scaffold0119 (1 HSPs) |
 |  |  |
|
| [»] scaffold0105 (2 HSPs) |
 |  |  |
|
| [»] scaffold0339 (1 HSPs) |
 |  |  |
|
| [»] scaffold0123 (1 HSPs) |
 |  |  |
|
| [»] scaffold0007 (2 HSPs) |
 |  |  |
|
| [»] scaffold0002 (3 HSPs) |
 |  |  |
|
| [»] scaffold0684 (2 HSPs) |
 |  |  |
|
| [»] scaffold0085 (2 HSPs) |
 |  |  |
|
| [»] scaffold0078 (2 HSPs) |
 |  |  |
|
| [»] scaffold0472 (1 HSPs) |
 |  |  |
|
| [»] scaffold0176 (3 HSPs) |
 |  |  |
|
| [»] scaffold0578 (1 HSPs) |
 |  |  |
|
| [»] scaffold0106 (1 HSPs) |
 |  |  |
|
| [»] scaffold0204 (1 HSPs) |
 |  |  |
|
| [»] scaffold0011 (1 HSPs) |
 |  |  |
|
| [»] scaffold0008 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 252)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 240 - 486
Target Start/End: Complemental strand, 7898524 - 7898279
Alignment:
| Q |
240 |
atctcaattgtcaatttgaaattaaacaacttaaatttgttacagcgtccttcatagataaatcatgttttaagggcggatttcttgcttgttttgcttc |
339 |
Q |
| |
|
|||||||| |||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
7898524 |
atctcaatcgtcaatttgaaattaagcgacttaaatttgttacagcgtccttcatagataaatcatgttttaaggg---atttcttgcttgttttacttc |
7898428 |
T |
 |
| Q |
340 |
acaacattcattgcaaacttgtttaggtactttgatatggggaagtccatttaccataccgttt--gcattcattatgcacaagcttctaaagtttagat |
437 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
7898427 |
acaacattcatcgcaaacttgtttaggtactttgatatggggaagtccatttaccataccttttttgcattcattatgcacaagcttctaaagtttagat |
7898328 |
T |
 |
| Q |
438 |
gcccgtatttgtgatgccatgtccagttttcactcaaaactgtagctgc |
486 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7898327 |
gcccgtatttgtgatgccatgtccagttttcactcaaaactgtagctgc |
7898279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 183; E-Value: 9e-99
Query Start/End: Original strand, 278 - 486
Target Start/End: Complemental strand, 7883740 - 7883535
Alignment:
| Q |
278 |
gttacagcgtccttcatagataaatcatgttttaagggcggatttcttgcttgttttgcttcacaacattcattgcaaacttgtttaggtactttgatat |
377 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7883740 |
gttacagcgtccttcatatataaatcatgttttgaggg---atttcttgcttgttttgcttcacaacattcattgcaaacttgtttaggtactttgatat |
7883644 |
T |
 |
| Q |
378 |
ggggaagtccatttaccataccgtttgcattcattatgcacaagcttctaaagtttagatgcccgtatttgtgatgccatgtccagttttcactcaaaac |
477 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7883643 |
ggggaagttcatttaccataccgtttgcattcattatgcacaagcttctaaagtttagatgcccgtatttgtgatgccatgtccagttttcactcaaaac |
7883544 |
T |
 |
| Q |
478 |
tgtagctgc |
486 |
Q |
| |
|
||||||||| |
|
|
| T |
7883543 |
tgtagctgc |
7883535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 157 - 239
Target Start/End: Original strand, 45290457 - 45290539
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccca |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
45290457 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccca |
45290539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 74; E-Value: 9e-34
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 18473272 - 18473353
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
18473272 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccc |
18473353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 74; E-Value: 9e-34
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 32729049 - 32728968
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
32729049 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccc |
32728968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 990379 - 990298
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
990379 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaatttgtttttggtccc |
990298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 21391096 - 21391177
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
21391096 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtgaaaaaaaaaattgtttttggtccc |
21391177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 45290820 - 45290739
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
45290820 |
ggctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccc |
45290739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 19622655 - 19622737
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaa-ttgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||| |||||||||||||| |
|
|
| T |
19622655 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcccttgtaaaaaaaaaatttgtttttggtccc |
19622737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 160 - 238
Target Start/End: Complemental strand, 31258699 - 31258621
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| |||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
31258699 |
taaaatatggttttagtccctgcaaatatgcctcgtttttgttttagtccctggtaaaaaaaaaattgtttttggtccc |
31258621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 152 - 238
Target Start/End: Complemental strand, 41358668 - 41358582
Alignment:
| Q |
152 |
aaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||| | |||||||||||||| |
|
|
| T |
41358668 |
aaataggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctggtaaaaaaatatttgtttttggtccc |
41358582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 14007489 - 14007568
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
14007489 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccct-gtaaa-aaaaaattgtttttggtccc |
14007568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 19623017 - 19622937
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
19623017 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctggtaaa-aaaaaattgtttttggtccc |
19622937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 48609236 - 48609316
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
48609236 |
ggctaaaatatggttttagtcccggcaaatatgtctcgttttggttttagtccct-gtaaaaaaaaaattgtttttggtccc |
48609316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 155 - 238
Target Start/End: Complemental strand, 7001899 - 7001815
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaa-aaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||| || |||||||||||||| |
|
|
| T |
7001899 |
ttggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaataatttgtttttggtccc |
7001815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 990088 - 990170
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt-aaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |||||||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
990088 |
ggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctggtaaaaaaaaaaattgtttttggtccc |
990170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 157 - 235
Target Start/End: Complemental strand, 6567496 - 6567420
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggt |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
6567496 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccct-gtaaa-aaaaaattgtttttggt |
6567420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 18473595 - 18473513
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt-aaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||| || ||| |||||||||||||||||||| |
|
|
| T |
18473595 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctagtaaaaaaaaaaattgtttttggtccc |
18473513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 155 - 237
Target Start/End: Complemental strand, 22953558 - 22953476
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtcc |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||| ||||||||||||||||||| |
|
|
| T |
22953558 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagatcctgtgaaaaaaaaaattgtttttggtcc |
22953476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 26061956 - 26062038
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt-aaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||| |||||||| ||||||||||| |
|
|
| T |
26061956 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaaattatttttggtccc |
26062038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 157 - 235
Target Start/End: Original strand, 45368490 - 45368568
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggt |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
45368490 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaaattgtttttggt |
45368568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 155 - 233
Target Start/End: Complemental strand, 46868579 - 46868502
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttg |
233 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
46868579 |
ttggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctgg-aaaaaaaaaattgtttttg |
46868502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 158 - 235
Target Start/End: Original strand, 27521577 - 27521653
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggt |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
27521577 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccct-gtaaaaaaaaaattgtttttggt |
27521653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 157 - 237
Target Start/End: Original strand, 11822004 - 11822083
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtcc |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||| ||| ||||| ||||||||||||||||||| |
|
|
| T |
11822004 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt-ccttgtaaaaaaaaaattgtttttggtcc |
11822083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 157 - 237
Target Start/End: Original strand, 13770489 - 13770569
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtcc |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||| ||||| ||||||||||||| |
|
|
| T |
13770489 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaatttgtttttggtcc |
13770569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 157 - 237
Target Start/End: Original strand, 22919684 - 22919762
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtcc |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
22919684 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct-gtaaa-aaaaaattgtttttggtcc |
22919762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 153 - 237
Target Start/End: Original strand, 26191355 - 26191438
Alignment:
| Q |
153 |
aattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtcc |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||| ||||| ||||||||||||||||||| |
|
|
| T |
26191355 |
aattggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagt-ccttgtaaaaaaaaaattgtttttggtcc |
26191438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 158 - 237
Target Start/End: Original strand, 44641079 - 44641157
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtcc |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
44641079 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct-ataaaaaaaaaattgtttttggtcc |
44641157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 156 - 238
Target Start/End: Complemental strand, 3679987 - 3679906
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||||||||| |||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
3679987 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagtccctgttaaa-aaaaaattgtttttggtccc |
3679906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 160 - 238
Target Start/End: Original strand, 18899842 - 18899918
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||| |||||||||||||||||||| |
|
|
| T |
18899842 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcct-gtaaa-aaaaaattgtttttggtccc |
18899918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 160 - 238
Target Start/End: Complemental strand, 18900130 - 18900053
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
18900130 |
taaaatatggttttagtccctgcaaatatgactcgttttggttttagtccct-gtaataaaaaaattgtttttggtccc |
18900053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 29072497 - 29072579
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg-gtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
29072497 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaaaattgtttttggtccc |
29072579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 31258339 - 31258421
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaa-aaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||| ||| || |||||||||||||| |
|
|
| T |
31258339 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggtaaaaaaataatttgtttttggtccc |
31258421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 156 - 238
Target Start/End: Original strand, 37545627 - 37545708
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||||||||||||||||| | ||| |||||||||||||||||||| |
|
|
| T |
37545627 |
tggctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtccct-gcaaaaaaaaaattgtttttggtccc |
37545708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 157 - 223
Target Start/End: Original strand, 41881093 - 41881159
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaa |
223 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41881093 |
ggctaaaatatggttttagtccctccaaatatgtctcgttttggttttagtccctggtaaaaaaaaa |
41881159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 156 - 238
Target Start/End: Complemental strand, 44641433 - 44641353
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
44641433 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccct-gtaaa-aaaaaattgtttttggtccc |
44641353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 157 - 237
Target Start/End: Original strand, 1810927 - 1811008
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg-gtaaataaaaaattgtttttggtcc |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||| | ||| ||||| ||||||||||||| |
|
|
| T |
1810927 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtgcaaaaaaaaatttgtttttggtcc |
1811008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 158 - 238
Target Start/End: Original strand, 3753214 - 3753291
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
3753214 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct-gtaa--aaaaaattgtttttggtccc |
3753291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 145 - 237
Target Start/End: Complemental strand, 3753582 - 3753493
Alignment:
| Q |
145 |
atattttaaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtcc |
237 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| ||||||| ||||||||||||||||||||| || || ||||||||||||||||||| |
|
|
| T |
3753582 |
atattttaaa--ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccct-gtgaaaaaaaaattgtttttggtcc |
3753493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 148 - 229
Target Start/End: Original strand, 10631155 - 10631234
Alignment:
| Q |
148 |
ttttaaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtt |
229 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
10631155 |
ttttcaattggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct-gtaaa-aaaaaattgtt |
10631234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 33379888 - 33379968
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||| | || |||||||||||||||||||| |
|
|
| T |
33379888 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct-atgaaaaaaaaattgtttttggtccc |
33379968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 157 - 222
Target Start/End: Original strand, 41358369 - 41358434
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaa |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
41358369 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaa |
41358434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 157 - 237
Target Start/End: Complemental strand, 48609594 - 48609513
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg-gtaaataaaaaattgtttttggtcc |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||| ||||||||||||| |
|
|
| T |
48609594 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcactgtaaaaataaaaatttgtttttggtcc |
48609513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 154 - 238
Target Start/End: Complemental strand, 48956069 - 48955984
Alignment:
| Q |
154 |
attggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaa-attgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| || ||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
48956069 |
attggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctgtaaaataaaaattttgtttttggtccc |
48955984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 154 - 234
Target Start/End: Original strand, 24649347 - 24649427
Alignment:
| Q |
154 |
attggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttgg |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||| ||| ||||| |||||||||| |
|
|
| T |
24649347 |
attggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagcccctgaaaaaaaaaaatttgtttttgg |
24649427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 157 - 233
Target Start/End: Original strand, 50799130 - 50799205
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttg |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
50799130 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccct-gtaaaaaaaaaattgtttttg |
50799205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 13260321 - 13260266
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13260321 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
13260266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 154 - 238
Target Start/End: Complemental strand, 35308114 - 35308029
Alignment:
| Q |
154 |
attggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaa--ttgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| | |||| |||||||||||||| |
|
|
| T |
35308114 |
attggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct-gtaaaaagaaaattttgtttttggtccc |
35308029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 155 - 238
Target Start/End: Complemental strand, 52254481 - 52254400
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||| ||||| |||||| ||||||||||||| |
|
|
| T |
52254481 |
ttggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccct-gtaaa-aaaaaaatgtttttggtccc |
52254400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 44 - 134
Target Start/End: Complemental strand, 7898593 - 7898503
Alignment:
| Q |
44 |
tagggagtggttaccattggaccccgattttctattgtagggattttcggtggtttcacgttgtagtccatctcagccgttaatttgaaat |
134 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||| ||||||| ||||||||||| ||||||| ||||||| ||| |||||||||| |
|
|
| T |
7898593 |
tagggagtggttaccattggaaccagattttctattgtatggattttaggtggtttcacattgtagttcatctcaatcgtcaatttgaaat |
7898503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 144 - 229
Target Start/End: Original strand, 8140420 - 8140504
Alignment:
| Q |
144 |
catattttaaatt-ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtt |
229 |
Q |
| |
|
||||||| ||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
8140420 |
catatttaaaattaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct-gtaaa-aaaaaattgtt |
8140504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 24977775 - 24977833
Alignment:
| Q |
154 |
attggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24977775 |
attggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
24977833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 156 - 226
Target Start/End: Complemental strand, 26191735 - 26191666
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaatt |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||| |||||||| |
|
|
| T |
26191735 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt-ccttgtaaaaaaaaaatt |
26191666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 155 - 238
Target Start/End: Complemental strand, 29072864 - 29072779
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg--gtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
29072864 |
ttggctaaaatatggttttagtccctgcaaatatgcctcgctttggttttagtccctgtaaaaaaaaaaaaattgtttttggtccc |
29072779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 157 - 235
Target Start/End: Complemental strand, 50429209 - 50429131
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggt |
235 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |||||||||||||||||||||| ||| ||||| ||||||||||| |
|
|
| T |
50429209 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaatttgtttttggt |
50429131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 13259988 - 13260067
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| ||||| ||||||||||||||| |||| |
|
|
| T |
13259988 |
ggctaaaatatggttttagtcgctgcaaatatggctcgttttggttttagtccct-gtaaa-aaaaaattgtttttgttccc |
13260067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 157 - 237
Target Start/End: Original strand, 32626529 - 32626610
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg-gtaaataaaaaattgtttttggtcc |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||| |||||| |||||||||||| |
|
|
| T |
32626529 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgtaaaaaaaaaaaaatgtttttggtcc |
32626610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 40718108 - 40718165
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40718108 |
ttggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
40718165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 48955714 - 48955794
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |||||||||||||||||| || |||| |||||||||||||||||||| |
|
|
| T |
48955714 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtctttgttaaa-aaaaaattgtttttggtccc |
48955794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 52254183 - 52254262
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||| ||| ||||| |||||||||||||||||||| |
|
|
| T |
52254183 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagt-ccttgtaaa-aaaaaattgtttttggtccc |
52254262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 157 - 229
Target Start/End: Original strand, 3247198 - 3247268
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtt |
229 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
3247198 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct-gtaaa-aaaaaattgtt |
3247268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 157 - 237
Target Start/End: Original strand, 3679626 - 3679704
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtcc |
237 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| ||||||||||||||||||||| ||||| |||||||||||| |||||| |
|
|
| T |
3679626 |
ggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccct-gtaaa-aaaaaattgtttctggtcc |
3679704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 158 - 238
Target Start/End: Original strand, 7818783 - 7818862
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||||||||||||||||| || ||||| |||||||||||||||||||| |
|
|
| T |
7818783 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtttct-gtaaaaaaaaaattgtttttggtccc |
7818862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 174 - 238
Target Start/End: Original strand, 18302070 - 18302133
Alignment:
| Q |
174 |
agtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
18302070 |
agtccctgcaaatatgtctcgttttggttttagtccct-gtaaaaaaaaaattgtttttggtccc |
18302133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 157 - 229
Target Start/End: Original strand, 19720712 - 19720782
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtt |
229 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
19720712 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct-gtaaa-aaaaaattgtt |
19720782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 26442563 - 26442615
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26442563 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
26442615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 148 - 212
Target Start/End: Complemental strand, 34002949 - 34002885
Alignment:
| Q |
148 |
ttttaaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
34002949 |
ttttaaaaaggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtccctg |
34002885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 156 - 212
Target Start/End: Original strand, 35056529 - 35056585
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35056529 |
tggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35056585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 11822365 - 11822310
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
11822365 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgcttttagtccctg |
11822310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 12360968 - 12360913
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12360968 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
12360913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 15526362 - 15526307
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15526362 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
15526307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 18302387 - 18302332
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
18302387 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
18302332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 160 - 234
Target Start/End: Complemental strand, 26062255 - 26062180
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaa-ttgtttttgg |
234 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||||||||| ||||||||| |||||| |||||||||| |
|
|
| T |
26062255 |
taaaatatggttttagtccctgtaaatatgtctcattttggttttagttcctggtaaaaaaaaaatttgtttttgg |
26062180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 29688428 - 29688351
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
29688428 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccct--taa--aaaaaattgtttttggtccc |
29688351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 30322929 - 30322984
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30322929 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
30322984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 33000669 - 33000614
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33000669 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
33000614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 160 - 238
Target Start/End: Original strand, 34808200 - 34808275
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||| |||| |||||| ||||||||||||| |
|
|
| T |
34808200 |
taaaatatggttttagtcccttcaaatatgtctcgttttggttttagtccct-gtaa--aaaaaaatgtttttggtccc |
34808275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 158 - 225
Target Start/End: Original strand, 39303675 - 39303741
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaat |
225 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
39303675 |
gctaaaatatggttttagtccctgcaagtatgtctcgttttggttttagtccct-gtaaaaaaaaaat |
39303741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 39747835 - 39747780
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39747835 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
39747780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 45380272 - 45380327
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45380272 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
45380327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 157 - 211
Target Start/End: Complemental strand, 10887598 - 10887544
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccct |
211 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10887598 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
10887544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 12322973 - 12322915
Alignment:
| Q |
154 |
attggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
12322973 |
attggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttaatccctg |
12322915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 155 - 229
Target Start/End: Complemental strand, 38151214 - 38151142
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtt |
229 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
38151214 |
ttggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccct-gtaaa-aaaaaattgtt |
38151142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 162 - 238
Target Start/End: Original strand, 2939934 - 2940007
Alignment:
| Q |
162 |
aaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||| |||||||||||||| ||||||||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
2939934 |
aaatatggttttaatccctgcaaatatgcctcgttttggttttagtccct-gtaa--aaaaaattgtttttggtccc |
2940007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 159 - 212
Target Start/End: Original strand, 4789310 - 4789363
Alignment:
| Q |
159 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4789310 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
4789363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 12361011 - 12361092
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||| || |||||||||||||||||||||| ||| |||| |||||||| ||||| |
|
|
| T |
12361011 |
ggctaaaatatggttttagtccctgcaaatttgcctcgttttggttttagtccctgtaaaaaaaaagtttgtttttcgtccc |
12361092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 21383104 - 21383183
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||||||||||||||||||||| ||||| || ||| ||||||||||||| |
|
|
| T |
21383104 |
ggctaaaatatgattttagtccctgctaatatgtctcgttttggttttagtccct-gtaaa-aataaaatgtttttggtccc |
21383183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 24653800 - 24653857
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
24653800 |
ttggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
24653857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 31060785 - 31060842
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
31060785 |
ttggctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtccctg |
31060842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 152 - 229
Target Start/End: Original strand, 42482974 - 42483050
Alignment:
| Q |
152 |
aaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtt |
229 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||||||| |||||||||||||| || ||||| ||||||||||| |
|
|
| T |
42482974 |
aaataggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtctct-gtaaaaaaaaaattgtt |
42483050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 147 - 212
Target Start/End: Original strand, 47819222 - 47819287
Alignment:
| Q |
147 |
attttaaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||| |||| ||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
47819222 |
atttaaaataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
47819287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 17984333 - 17984418
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt----aaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |||||||||||||||||| ||| | ||| |||||||||||||||||||| |
|
|
| T |
17984333 |
ggctaaaatatggtttgagtccctgcaaatatgcctcgttttggttttagtctctgttaaaaaaaaaaaaaattgtttttggtccc |
17984418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 26442899 - 26442817
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaa--ttgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||||||||||||||||||||| ||||| | |||| |||||||||||||| |
|
|
| T |
26442899 |
ggctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtccct-gtaaaaagaaaattttgtttttggtccc |
26442817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #94
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 32454294 - 32454209
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg----gtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||| ||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
32454294 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggctttagtccctgtaaaaaaaaaaaaaaattgtttttggtccc |
32454209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #95
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 35005744 - 35005692
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
35005744 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
35005692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #96
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 160 - 212
Target Start/End: Original strand, 38150851 - 38150903
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38150851 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
38150903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #97
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 145 - 212
Target Start/End: Complemental strand, 47819606 - 47819541
Alignment:
| Q |
145 |
atattttaaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||| ||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
47819606 |
atattttaaa--ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
47819541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #98
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 7867129 - 7867184
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
7867129 |
ggctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtccctg |
7867184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #99
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 10631528 - 10631473
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
10631528 |
ggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg |
10631473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #100
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 10887233 - 10887288
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
10887233 |
ggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctg |
10887288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #101
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 160 - 238
Target Start/End: Complemental strand, 15335292 - 15335213
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaa-attgtttttggtccc |
238 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||||||||||||||| |||| ||||||||| |||||||||||||| |
|
|
| T |
15335292 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctgtaaaataaaaattttgtttttggtccc |
15335213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #102
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 24507843 - 24507788
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
24507843 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
24507788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #103
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 161 - 238
Target Start/End: Complemental strand, 24649656 - 24649577
Alignment:
| Q |
161 |
aaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg-gtaaataaaaaa-ttgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||||||||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
24649656 |
aaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgtaaaaataaaaaatttgtttttggtccc |
24649577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #104
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 24654167 - 24654112
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
24654167 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagcccctg |
24654112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #105
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 33045690 - 33045635
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
33045690 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
33045635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #106
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 35005444 - 35005499
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
35005444 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
35005499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #107
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 35307715 - 35307770
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
35307715 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg |
35307770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #108
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 38164295 - 38164240
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
38164295 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
38164240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #109
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 159 - 238
Target Start/End: Complemental strand, 45368847 - 45368770
Alignment:
| Q |
159 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| ||||||||||||||||||||| ||||| |||||||| ||||||||||| |
|
|
| T |
45368847 |
ctaaaatatgattttagtctctgcaaatatgcctcgttttggttttagtccct-gtaaa-aaaaaattatttttggtccc |
45368770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #110
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 166 - 236
Target Start/End: Original strand, 292868 - 292937
Alignment:
| Q |
166 |
atggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtc |
236 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| ||||||||||| |||| |||||||||||||||||| |
|
|
| T |
292868 |
atggttttagtccctgcaaatatgcctcgttttgcttttagtccct-ataaaaaaaaaattgtttttggtc |
292937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #111
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 7819103 - 7819021
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg-gtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||| || ||||||||||| |||||||||||||||||| ||| ||| |||||||||||||||||||| |
|
|
| T |
7819103 |
ggctaaaatatggttttaatctctgcaaatatgcctcgttttggttttagtctctgtaaaaaaaaaaaattgtttttggtccc |
7819021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #112
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 24507476 - 24507534
Alignment:
| Q |
154 |
attggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
24507476 |
attggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctg |
24507534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #113
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 158 - 212
Target Start/End: Original strand, 32420099 - 32420153
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
32420099 |
gctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctg |
32420153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #114
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 158 - 212
Target Start/End: Original strand, 44157696 - 44157750
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
44157696 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
44157750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #115
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 45638577 - 45638635
Alignment:
| Q |
154 |
attggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
45638577 |
attggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
45638635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #116
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 158 - 223
Target Start/End: Original strand, 4323829 - 4323894
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaa |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| |||||||| ||| ||||||||| |
|
|
| T |
4323829 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtctctgtaaaataaaaa |
4323894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #117
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 157 - 230
Target Start/End: Complemental strand, 4360626 - 4360555
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgttt |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||| |||| ||||| |||||||||||| |
|
|
| T |
4360626 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttggggttttagcccct-gtaaa-aaaaaattgttt |
4360555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #118
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 160 - 209
Target Start/End: Original strand, 7350426 - 7350475
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
7350426 |
taaaatatggttttagtccctgcaaatatgtctcattttggttttagtcc |
7350475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #119
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 16060887 - 16060830
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
16060887 |
ttggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg |
16060830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #120
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 155 - 208
Target Start/End: Complemental strand, 17984703 - 17984650
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
17984703 |
ttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
17984650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #121
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 20948753 - 20948810
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
20948753 |
ttggctaaaatatggttttggtccctacaaatatgtctcgtttgggttttagtccctg |
20948810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #122
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 25658012 - 25658069
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
25658012 |
ttggctaaaatatggttttggtccccgcaaatatgtctcgttttggttttaatccctg |
25658069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #123
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 159 - 212
Target Start/End: Original strand, 26207280 - 26207333
Alignment:
| Q |
159 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
26207280 |
ctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctg |
26207333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #124
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 147 - 212
Target Start/End: Complemental strand, 28507468 - 28507403
Alignment:
| Q |
147 |
attttaaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||| ||||||||||| ||||| ||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
28507468 |
attttaaataggctaaaatattgttttggtccctgcaaatatgtctcattttagttttagtccctg |
28507403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #125
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 38136983 - 38136926
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
38136983 |
ttggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
38136926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #126
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 45380638 - 45380581
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
45380638 |
ttggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
45380581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #127
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 160 - 212
Target Start/End: Complemental strand, 3247559 - 3247507
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3247559 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
3247507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #128
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 152 - 212
Target Start/End: Complemental strand, 16026943 - 16026883
Alignment:
| Q |
152 |
aaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
16026943 |
aaataggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg |
16026883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #129
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 162 - 238
Target Start/End: Complemental strand, 16083394 - 16083318
Alignment:
| Q |
162 |
aaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||| |||||||| ||| ||| ||||| |||||||||||||| |
|
|
| T |
16083394 |
aaatatggttttagtccctgcaaatatacctcgttttgattttagtctctgtaaaaaaaaaatttgtttttggtccc |
16083318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #130
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 157 - 237
Target Start/End: Complemental strand, 22919977 - 22919897
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtcc |
237 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||||||| |||||||||| || ||| |||| ||||||||||||| |
|
|
| T |
22919977 |
ggctaaaatatggttttagtctctgcaaatatgcctcgttttagttttagtccttgtaaaaaaaaatgttgtttttggtcc |
22919897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #131
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 157 - 229
Target Start/End: Original strand, 26324585 - 26324655
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtt |
229 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
26324585 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccct-gtaaa-aaaaaattgtt |
26324655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #132
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 33067348 - 33067400
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
33067348 |
ggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttggtcc |
33067400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #133
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 160 - 212
Target Start/End: Original strand, 38163934 - 38163986
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
38163934 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
38163986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #134
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 157 - 205
Target Start/End: Complemental strand, 45638894 - 45638846
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
205 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
45638894 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
45638846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #135
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 146 - 210
Target Start/End: Original strand, 46183673 - 46183737
Alignment:
| Q |
146 |
tattttaaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccc |
210 |
Q |
| |
|
|||||||| ||| ||||||||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
46183673 |
tattttaagttgactaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccc |
46183737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #136
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 7867357 - 7867302
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
7867357 |
ggctaaaatatggttttggtccctgcaaatatgtcttattttggttttagtccctg |
7867302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #137
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 8140799 - 8140744
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| || |||||||||||| |||||||||||||||||||||| |
|
|
| T |
8140799 |
ggctaaaatatggttttggtacctgcaaatatgcctcgttttggttttagtccctg |
8140744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #138
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 12158690 - 12158745
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
12158690 |
ggctaaaatatggttttagtctctgcaaatatgcatcgttttggttttagtccctg |
12158745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #139
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 158 - 209
Target Start/End: Original strand, 15058419 - 15058470
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
15058419 |
gctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtcc |
15058470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #140
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 208
Target Start/End: Original strand, 15211511 - 15211562
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
15211511 |
ggctaaaatatggttttggtccctgtaaatatgtctcgttttggttttagtc |
15211562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #141
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 15516582 - 15516637
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
15516582 |
ggctaaaatatggttttggtccctgcaaatatgccttgttttggttttagtccctg |
15516637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #142
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 208
Target Start/End: Original strand, 16083047 - 16083098
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
16083047 |
ggctaaaatatggttttagtccccgcaaatatgtctcgtttttgttttagtc |
16083098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #143
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 30323293 - 30323238
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
30323293 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
30323238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #144
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 31061151 - 31061096
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
31061151 |
ggctaaaatatggttttgatccctgcaaatatatctcgttttggttttagtccctg |
31061096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #145
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 33000305 - 33000360
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
33000305 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctg |
33000360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #146
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 33234546 - 33234601
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
33234546 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg |
33234601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #147
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 35056894 - 35056839
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
35056894 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
35056839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #148
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 50428873 - 50428928
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| ||||| |||||| |
|
|
| T |
50428873 |
ggctaaaatatggttttagtccttgcaaatatgtctcgttttgcttttaatccctg |
50428928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #149
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 159 - 205
Target Start/End: Complemental strand, 17130081 - 17130035
Alignment:
| Q |
159 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
205 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
17130081 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
17130035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #150
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 155 - 229
Target Start/End: Original strand, 41738794 - 41738866
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtt |
229 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| |||| |||||||||||| ||||| ||||||||||| |
|
|
| T |
41738794 |
ttggctaaaatatggttttggtccctgcaaatatgcctcattttagttttagtccct-gtaaa-aaaaaattgtt |
41738866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #151
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 157 - 211
Target Start/End: Complemental strand, 44158042 - 44157988
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccct |
211 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| || |||||||||||||||||| |
|
|
| T |
44158042 |
ggctaaaatatggtttttgtccctgcaaatatgcctagttttggttttagtccct |
44157988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #152
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 157 - 211
Target Start/End: Original strand, 49073691 - 49073745
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccct |
211 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
49073691 |
ggctaaaatatggttttggtccttgcaaatatgtctcgttttggttttaatccct |
49073745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #153
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 147 - 212
Target Start/End: Complemental strand, 4565346 - 4565281
Alignment:
| Q |
147 |
attttaaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||| ||| ||||||||||||||| | |||||||||||||||||||||||| |||||||||||| |
|
|
| T |
4565346 |
atttttaataggctaaaatatggttctggtccctgcaaatatgtctcgttttaattttagtccctg |
4565281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #154
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 14007875 - 14007794
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||| |||||||| || | ||||||| |||||||| ||||||||| ||| |||| ||||||||| |||||||||| |
|
|
| T |
14007875 |
ggctaaaatatagttttagtacccgtaaatatgcctcgttttagttttagtctctgttaaaaaaaaaattgattttggtccc |
14007794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #155
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 160 - 237
Target Start/End: Original strand, 20756022 - 20756099
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtcc |
237 |
Q |
| |
|
||||||||| ||||| ||| || ||||||||||||||||||||||||||| || ||| ||||| ||||||||||||| |
|
|
| T |
20756022 |
taaaatatgattttaatccttgtaaatatgtctcgttttggttttagtccttgtaaaaaaaaaatttgtttttggtcc |
20756099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #156
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 156 - 229
Target Start/End: Complemental strand, 24510309 - 24510237
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtt |
229 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||| |||||||| ||| ||||| ||||||||||| |
|
|
| T |
24510309 |
tggctaaaatatggttttggtccctgcaaatatggttcgttttagttttagtacctagtaaa-aaaaaattgtt |
24510237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #157
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 158 - 235
Target Start/End: Original strand, 34382948 - 34383024
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggt |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| ||||||||||||| ||| ||| |||||||| |||||||| |
|
|
| T |
34382948 |
gctaaaatatggttttagtccctgcaaatatacctcg-tttggttttagtctctgtaaaaaaaaaaattatttttggt |
34383024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #158
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 41739120 - 41739068
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
41739120 |
ggctaaaatatggttttagtccctgcaaatat---tcgttttggttttagtccctg |
41739068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #159
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 160 - 212
Target Start/End: Complemental strand, 19721071 - 19721019
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||| |||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
19721071 |
taaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
19721019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #160
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 152 - 208
Target Start/End: Complemental strand, 26324952 - 26324896
Alignment:
| Q |
152 |
aaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
|||| |||||||||||| ||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
26324952 |
aaataggctaaaatatgattttagtccatgcaaatatgcctcgttttggttttagtc |
26324896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #161
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 156 - 212
Target Start/End: Complemental strand, 33234913 - 33234857
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
33234913 |
tggctaaaatatgattttggtccctgcaaatatgcctcgttttgattttagtccctg |
33234857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #162
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 37624746 - 37624798
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
37624746 |
ggctaaaatatggttctagtccctgcaaatatgcctcgttttggttttggtcc |
37624798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #163
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 152 - 212
Target Start/End: Complemental strand, 40718479 - 40718419
Alignment:
| Q |
152 |
aaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| | |||||| |||||||||||| |
|
|
| T |
40718479 |
aaattggctaaaatatggttttggtccctgcaaatatgcatagttttgattttagtccctg |
40718419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #164
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 8364916 - 8364861
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||| ||||| ||||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
8364916 |
ggctaaaatatagttttggtccccgcaaatatgtctcgttttggttttcgtccctg |
8364861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #165
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 157 - 208
Target Start/End: Original strand, 22674203 - 22674254
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
22674203 |
ggctaaaatatggtttaggtccatgcaaatatgtctcgttttggttttagtc |
22674254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #166
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 33045355 - 33045410
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
33045355 |
ggctaaaatttggttttggtccctgcaaatatgcctagttttggttttagtccctg |
33045410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #167
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 158 - 205
Target Start/End: Complemental strand, 33067729 - 33067682
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
205 |
Q |
| |
|
|||||||||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
33067729 |
gctaaaatatcgttttagtccttgcaaatatgtctcgttttggtttta |
33067682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #168
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 156 - 211
Target Start/End: Complemental strand, 39025382 - 39025328
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccct |
211 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
39025382 |
tggctaaaatatggttttggtccctgcaaa-atgcctcgttttggttttagtccct |
39025328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #169
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 39747474 - 39747528
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| |||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
39747474 |
ggctaaaatatggttttggtcc-tgcaaatacgtctcgttttggttttagtccctg |
39747528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #170
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 157 - 239
Target Start/End: Original strand, 46868226 - 46868309
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg-gtaaataaaaaattgtttttggtccca |
239 |
Q |
| |
|
||||||| |||| |||||||||||||||||||| || |||||||||||||| ||| ||| ||||||||||||||||||||| |
|
|
| T |
46868226 |
ggctaaattatgattttagtccctgcaaatatgcttcattttggttttagtctctgtaaaaaaaaaaaattgtttttggtccca |
46868309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #171
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 155 - 209
Target Start/End: Original strand, 12322602 - 12322656
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||| ||||||||| |
|
|
| T |
12322602 |
ttggctaaaatatggttttgatccctgcaaatatgtttcgttttgattttagtcc |
12322656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #172
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 157 - 207
Target Start/End: Complemental strand, 15058766 - 15058716
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
207 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
15058766 |
ggctaaaatattgttttgatccctgcaaatatgtctcgttttggttttagt |
15058716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #173
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 157 - 199
Target Start/End: Complemental strand, 18079660 - 18079618
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttg |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
18079660 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttg |
18079618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #174
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 160 - 236
Target Start/End: Complemental strand, 21391371 - 21391298
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtc |
236 |
Q |
| |
|
|||||||||||||||||||||| ||||||| |||||||| ||||||||| ||| | |||||||||||||||||| |
|
|
| T |
21391371 |
taaaatatggttttagtccctgtaaatatgcctcgttttagttttagtctctgtga---aaaaaattgtttttggtc |
21391298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #175
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 157 - 199
Target Start/End: Original strand, 36912853 - 36912895
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttg |
199 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
36912853 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttg |
36912895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #176
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 158 - 208
Target Start/End: Complemental strand, 37625026 - 37624976
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| ||||||||||| ||||| |
|
|
| T |
37625026 |
gctaaaatatggttttagtccctgtaaatatgtatcgttttggttgtagtc |
37624976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #177
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 157 - 223
Target Start/End: Original strand, 47038866 - 47038932
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaa |
223 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| || |||| |||||| |||||||||||| ||||| |
|
|
| T |
47038866 |
ggctaaaatatgtttttagtccctgcaaatatagctagtttgggttttggtccctggtaaaaaaaaa |
47038932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #178
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 160 - 237
Target Start/End: Complemental strand, 4324163 - 4324088
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtcc |
237 |
Q |
| |
|
||||||||| ||||||| | |||||||||||||||||||||||||| | ||| ||||| |||||| |||||||||||| |
|
|
| T |
4324163 |
taaaatatgattttagttcatgcaaatatgtctcgttttggttttaat-ccttgtaaa-aaaaaaatgtttttggtcc |
4324088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #179
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 159 - 212
Target Start/End: Original strand, 17129691 - 17129744
Alignment:
| Q |
159 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||| | |||||||||||| |||||||||||||||||||||| |
|
|
| T |
17129691 |
ctaaaatatggttttgattcctgcaaatatgcctcgttttggttttagtccctg |
17129744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #180
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 26142420 - 26142501
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||| |||||| || | ||||||||| |||||||||||||||||| ||| ||| ||||| |||||||| ||||| |
|
|
| T |
26142420 |
ggctaaaatatagttttactctccgcaaatatgcctcgttttggttttagtcactgtaaaaaaaaaatttgttttttgtccc |
26142501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #181
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 160 - 209
Target Start/End: Original strand, 39025112 - 39025161
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| |||| |||| |
|
|
| T |
39025112 |
taaaatatggttttggtccctgcaaatatgtctcgttttgattttcgtcc |
39025161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #182
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 160 - 212
Target Start/End: Complemental strand, 5058989 - 5058937
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||| ||||||| ||||||| ||||||||| |||||||||||| |
|
|
| T |
5058989 |
taaaatatggttttggtccctggaaatatgcctcgttttgattttagtccctg |
5058937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #183
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 160 - 208
Target Start/End: Original strand, 8364619 - 8364667
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
8364619 |
taaaatatggttttgatccctgcaaatatgtttcgttttggttttagtc |
8364667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #184
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 156 - 212
Target Start/End: Complemental strand, 15211859 - 15211803
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| ||||||||||||| | |||||| |
|
|
| T |
15211859 |
tggctaaaatatggttttggtccttgcaaatatgcctcgttttggtttcaatccctg |
15211803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #185
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 157 - 229
Target Start/End: Original strand, 16026573 - 16026644
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtt |
229 |
Q |
| |
|
||||||||||| |||| |||||||||||||| ||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
16026573 |
ggctaaaatataattttggtccctgcaaatatccctcgttttggttttagtccct-ttaaaaaaaaaattgtt |
16026644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #186
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 158 - 210
Target Start/End: Complemental strand, 18928141 - 18928089
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccc |
210 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||| |||| ||||||||||| |
|
|
| T |
18928141 |
gctaaaatatggttttggtcgctgcaaatatgtctcattttagttttagtccc |
18928089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #187
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 148 - 204
Target Start/End: Original strand, 34002626 - 34002682
Alignment:
| Q |
148 |
ttttaaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttt |
204 |
Q |
| |
|
||||||| ||||||| |||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
34002626 |
ttttaaaaaggctaaagtatgattttggtccctgcaaatatgtctcgttttggtttt |
34002682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #188
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 156 - 212
Target Start/End: Complemental strand, 34383245 - 34383189
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||| ||||||| |||| |||||||| | ||||||||||||||||||| |
|
|
| T |
34383245 |
tggctaaaatatgattttagttcctgtaaatatgtattgttttggttttagtccctg |
34383189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #189
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 12360603 - 12360658
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||| ||||||| ||||| |
|
|
| T |
12360603 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttagttttagcccctg |
12360658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #190
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 157 - 208
Target Start/End: Original strand, 16060596 - 16060646
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
||||||||||||||||| |||||| |||||||| |||||||||||||||||| |
|
|
| T |
16060596 |
ggctaaaatatggttttggtccct-caaatatgcctcgttttggttttagtc |
16060646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #191
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 18079398 - 18079453
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||| |||||| |||| |||||||||| ||| |||||||||||||||||| |
|
|
| T |
18079398 |
ggctaaaatacggttttggtccttgcaaatatgcctcattttggttttagtccctg |
18079453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #192
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 30962416 - 30962471
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||| || ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
30962416 |
ggctaaaatatggcattggtccctgcaaatatgtccagttttggttttagtccctg |
30962471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #193
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 31404722 - 31404667
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| |||||| |||| |||||||||| | ||||||||||||| |
|
|
| T |
31404722 |
ggctaaaatatggttttggtccctacaaacatgtctcgttgttgttttagtccctg |
31404667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #194
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 183 - 238
Target Start/End: Original strand, 32453956 - 32454009
Alignment:
| Q |
183 |
aaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| ||||||||||||||| |||| |
|
|
| T |
32453956 |
aaatatgtctcgttttggttttagtccct-gtaaa-aaaaaattgtttttgatccc |
32454009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #195
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 156 - 238
Target Start/End: Complemental strand, 33380258 - 33380176
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccc-tgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||| ||| | |||||||| ||||||||||||||||| |||| ||| |||||| | ||||||||||| |
|
|
| T |
33380258 |
tggctaaaatatggttttagccccctacaaatatgcctcgttttggttttagt-cctgtgaaaaaaaaaaatatttttggtccc |
33380176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #196
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 156 - 238
Target Start/End: Complemental strand, 1159840 - 1159759
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||| ||||||| | ||||||| || || |||||||||||||||||| ||||| ||||| | ||||||| |||| |
|
|
| T |
1159840 |
tggctaaaatatgattttagttcttgcaaatgtgccttgttttggttttagtccct-gtaaaaaaaaattagtttttgatccc |
1159759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #197
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 159 - 209
Target Start/End: Original strand, 22953258 - 22953308
Alignment:
| Q |
159 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||| |||||| |||||||| |
|
|
| T |
22953258 |
ctaaaatatagttttagtccatgcaaatatgtctcattttggatttagtcc |
22953308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #198
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 170 - 212
Target Start/End: Complemental strand, 26324874 - 26324832
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
26324874 |
ttttggtccctgcaaatatgtctcgttttggttttcgtccctg |
26324832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #199
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 163 - 209
Target Start/End: Original strand, 32035442 - 32035488
Alignment:
| Q |
163 |
aatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
||||||||||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
32035442 |
aatatggttttgatctctgcaaatatgtctcgttttggttttagtcc |
32035488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #200
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 152 - 198
Target Start/End: Complemental strand, 32035793 - 32035747
Alignment:
| Q |
152 |
aaattggctaaaatatggttttagtccctgcaaatatgtctcgtttt |
198 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
32035793 |
aaataggctaaaatatggttttggtccctgcaaatatgtcttgtttt |
32035747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #201
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 159 - 209
Target Start/End: Complemental strand, 48730615 - 48730565
Alignment:
| Q |
159 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
||||||||||||||| |||| |||||||||| |||||||| |||||||||| |
|
|
| T |
48730615 |
ctaaaatatggttttggtccttgcaaatatgcctcgtttttgttttagtcc |
48730565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #202
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 160 - 205
Target Start/End: Original strand, 4360299 - 4360343
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
205 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
4360299 |
taaaatatggttttagtcc-tgcaaatatgtcttgttttggtttta |
4360343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #203
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 160 - 209
Target Start/End: Complemental strand, 7350733 - 7350684
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
|||||||||||||| ||| |||||||||| ||||||||||||||||||| |
|
|
| T |
7350733 |
taaaatatggttttggtcactgcaaatatacctcgttttggttttagtcc |
7350684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #204
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 157 - 234
Target Start/End: Original strand, 15334917 - 15334994
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttgg |
234 |
Q |
| |
|
|||||||||||||||||| || ||| ||||||| ||||||||||||||| | | || ||| ||||| |||||||||| |
|
|
| T |
15334917 |
ggctaaaatatggttttaatctctgtaaatatgactcgttttggttttaattcttgtaaaaaaaaaatttgtttttgg |
15334994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #205
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 157 - 226
Target Start/End: Complemental strand, 27264275 - 27264206
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaatt |
226 |
Q |
| |
|
|||||||||||| |||| |||||||||||||| | |||| |||||| |||||||||||| |||||||| |
|
|
| T |
27264275 |
ggctaaaatatgattttggtccctgcaaatatagcgagtttgggttttggtccctggtaaaaaaaaaatt |
27264206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #206
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 160 - 229
Target Start/End: Complemental strand, 46184051 - 46183984
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtt |
229 |
Q |
| |
|
|||||||| ||||| ||||||| ||||||||||| |||||||||| |||||| ||||| ||||||||||| |
|
|
| T |
46184051 |
taaaatatagttttggtccctgtaaatatgtctcattttggttttcgtccct-gtaaa-aaaaaattgtt |
46183984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #207
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 160 - 208
Target Start/End: Original strand, 4617091 - 4617139
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
|||||||||||||| ||||||| |||||||| ||||||| ||||||||| |
|
|
| T |
4617091 |
taaaatatggttttggtccctgaaaatatgtttcgttttagttttagtc |
4617139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #208
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 157 - 221
Target Start/End: Original strand, 24609919 - 24609983
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaa |
221 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| | |||| |||||| |||||| ||||||||| |
|
|
| T |
24609919 |
ggctaaaatatgtttttggtccctgcaaatatggcgagtttgggttttggtccctagtaaataaa |
24609983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #209
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 160 - 208
Target Start/End: Complemental strand, 32906237 - 32906189
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
||||||||| |||| |||| |||||||||||||||||||| |||||||| |
|
|
| T |
32906237 |
taaaatatgattttggtccttgcaaatatgtctcgttttgattttagtc |
32906189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #210
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Complemental strand, 3247489 - 3247446
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
3247489 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgg |
3247446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #211
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 157 - 224
Target Start/End: Complemental strand, 9774947 - 9774880
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaa |
224 |
Q |
| |
|
|||||||||||| |||| |||||||||||||| | |||| |||||| |||||||||||| |||||| |
|
|
| T |
9774947 |
ggctaaaatatgcttttggtccctgcaaatatagcgagtttgggttttggtccctggtaaaaaaaaaa |
9774880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #212
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Complemental strand, 15211783 - 15211740
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
15211783 |
ttttggtccttgcaaatatgtctcgttttggttttggtccctgg |
15211740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #213
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Complemental strand, 16026865 - 16026822
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
16026865 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgg |
16026822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #214
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 21383428 - 21383373
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||| |||||| ||| |||||||||| ||| ||||| |||||||||||| |
|
|
| T |
21383428 |
ggctaaaatatagttttaatccttgcaaatatgcctcattttgattttagtccctg |
21383373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #215
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 24507552 - 24507595
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
24507552 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgg |
24507595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #216
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 24978122 - 24978067
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||| ||||| |||| ||||||||| ||||||||||||||||| |||| |
|
|
| T |
24978122 |
ggctaaaatatagttttggtcctggcaaatatgcctcgttttggttttagttcctg |
24978067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #217
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Complemental strand, 30323220 - 30323177
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
30323220 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgg |
30323177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #218
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Complemental strand, 31061078 - 31061035
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
31061078 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgg |
31061035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #219
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Complemental strand, 33000596 - 33000553
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
33000596 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgg |
33000553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #220
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Complemental strand, 35056821 - 35056778
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
35056821 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgg |
35056778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #221
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Complemental strand, 38136908 - 38136865
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
38136908 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgg |
38136865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #222
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 38150921 - 38150964
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
38150921 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgg |
38150964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #223
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 38164004 - 38164047
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
38164004 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgg |
38164047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #224
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Complemental strand, 40718401 - 40718358
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
40718401 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgg |
40718358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #225
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 157 - 204
Target Start/End: Complemental strand, 42483271 - 42483224
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttt |
204 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| | ||||||||||| |
|
|
| T |
42483271 |
ggctaaaatatggttttggtccctgcaaatatgctttgttttggtttt |
42483224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #226
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 45380345 - 45380388
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
45380345 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgg |
45380388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #227
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 45638653 - 45638696
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
45638653 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgg |
45638696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #228
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 153 - 224
Target Start/End: Complemental strand, 46075113 - 46075042
Alignment:
| Q |
153 |
aattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaa |
224 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||| | |||| |||||| |||||||||||| |||||| |
|
|
| T |
46075113 |
aattggctaaaatatgtttttgatccctgcaaatatagcgagtttgggttttggtccctggtaaaaaaaaaa |
46075042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #229
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 47819305 - 47819348
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
47819305 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgg |
47819348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #230
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 49923818 - 49923763
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||||| |||||||| |||||||||||| |
|
|
| T |
49923818 |
ggctaaaatatgattttggtctctgcaaatatgcttcgttttgattttagtccctg |
49923763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #231
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 198 - 236
Target Start/End: Original strand, 2733226 - 2733263
Alignment:
| Q |
198 |
tggttttagtccctggtaaataaaaaattgtttttggtc |
236 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
2733226 |
tggttttagtccctggtaaa-aaaaaattgtttttggtc |
2733263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #232
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 15466129 - 15466187
Alignment:
| Q |
154 |
attggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||||||| |||| | | ||||| ||| |||||||||||||||||| |
|
|
| T |
15466129 |
attggctaaaatatggttttggtccttacggatatgcctcattttggttttagtccctg |
15466187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #233
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 170 - 212
Target Start/End: Complemental strand, 17130011 - 17129969
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
17130011 |
ttttggtccttgcaaatatgtctcgttttggttttggtccctg |
17129969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #234
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 158 - 212
Target Start/End: Complemental strand, 19198948 - 19198894
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||| || ||||||||||| ||| ||||| |||||||||||| |
|
|
| T |
19198948 |
gctaaaatatggttttgatctctgcaaatatgcctcattttgcttttagtccctg |
19198894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #235
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 170 - 212
Target Start/End: Complemental strand, 19721001 - 19720959
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
19721001 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
19720959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #236
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 153 - 227
Target Start/End: Original strand, 20722468 - 20722542
Alignment:
| Q |
153 |
aattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattg |
227 |
Q |
| |
|
||||||||||||| || |||| |||||||||||||| | ||| |||||| |||||||||||| ||||||||| |
|
|
| T |
20722468 |
aattggctaaaatgtgcttttggtccctgcaaatatagcgaatttgggttttggtccctggtaaaaaaaaaattg |
20722542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #237
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 178 - 212
Target Start/End: Original strand, 24509963 - 24509997
Alignment:
| Q |
178 |
cctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |
|
|
| T |
24509963 |
cctgcaaatatgtttcgttttggttttagtccctg |
24509997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #238
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 160 - 198
Target Start/End: Original strand, 31404429 - 31404467
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgtttt |
198 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
31404429 |
taaaatatgattttggtccctgcaaatatgtctcgtttt |
31404467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #239
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 157 - 223
Target Start/End: Complemental strand, 39163083 - 39163017
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaa |
223 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| | | || |||||| |||||||||||| ||||| |
|
|
| T |
39163083 |
ggctaaaatatgcttttggtccctgcaaatatggcgaggttgggttttggtccctggtaaaaaaaaa |
39163017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #240
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 170 - 211
Target Start/End: Original strand, 24977852 - 24977893
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccct |
211 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
24977852 |
ttttggtccctgcaaatatgtctcattttggttttggtccct |
24977893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #241
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 159 - 212
Target Start/End: Complemental strand, 25658299 - 25658246
Alignment:
| Q |
159 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||| |||| |||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
25658299 |
ctaaaatattcttttgatccctgcaaatatgcctcgttttgattttagtccctg |
25658246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #242
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 158 - 199
Target Start/End: Complemental strand, 26142671 - 26142630
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttg |
199 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||| ||||| |
|
|
| T |
26142671 |
gctaaaatatggttttaatccctgcaaatatgcctcattttg |
26142630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #243
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 157 - 226
Target Start/End: Original strand, 27262908 - 27262977
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaatt |
226 |
Q |
| |
|
|||||||||||| |||| |||||||||||||| | |||| ||||| |||||||||||| |||||||| |
|
|
| T |
27262908 |
ggctaaaatatgtttttggtccctgcaaatatagcgagtttgtgttttggtccctggtaaaaaaaaaatt |
27262977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #244
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 159 - 212
Target Start/End: Original strand, 29579322 - 29579375
Alignment:
| Q |
159 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||| |||| |||||||||| ||| |||| |||||||||||| |
|
|
| T |
29579322 |
ctaaaatatggtttttgtccttgcaaatatgcctcattttaattttagtccctg |
29579375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #245
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 176 - 213
Target Start/End: Original strand, 33234626 - 33234663
Alignment:
| Q |
176 |
tccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
33234626 |
tccctgcaaatatgtctcgttttgattttggtccctgg |
33234663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #246
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 157 - 189
Target Start/End: Complemental strand, 1811235 - 1811203
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatg |
189 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
1811235 |
ggctaaaatatgattttagtccctgcaaatatg |
1811203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #247
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 157 - 189
Target Start/End: Complemental strand, 2604186 - 2604154
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatg |
189 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
2604186 |
ggctaaaatatgtttttagtccctgcaaatatg |
2604154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #248
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 176 - 212
Target Start/End: Original strand, 12360682 - 12360718
Alignment:
| Q |
176 |
tccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
12360682 |
tccctgcaaatatgtcccgttttggttttggtccctg |
12360718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #249
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 198 - 238
Target Start/End: Complemental strand, 32626852 - 32626812
Alignment:
| Q |
198 |
tggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
32626852 |
tggttttagtccctgtaaaaaaaaaaattgtttttggtccc |
32626812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #250
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 198 - 238
Target Start/End: Complemental strand, 37545908 - 37545869
Alignment:
| Q |
198 |
tggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
37545908 |
tggttttagtccctg-taaaaaaaaaattgtttttggtccc |
37545869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #251
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 157 - 185
Target Start/End: Complemental strand, 41881346 - 41881318
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaa |
185 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
41881346 |
ggctaaaatatggttttagtccctgcaaa |
41881318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #252
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 150 - 218
Target Start/End: Original strand, 46073878 - 46073946
Alignment:
| Q |
150 |
ttaaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaat |
218 |
Q |
| |
|
|||||| |||||||||||| |||| ||||||||||||| | ||| |||||||||||||||||||| |
|
|
| T |
46073878 |
ttaaataggctaaaatatgcttttgatccctgcaaatatagcaaatttgggttttagtccctggtaaat |
46073946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 79; Significance: 1e-36; HSPs: 243)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 156 - 238
Target Start/End: Complemental strand, 50714566 - 50714484
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
50714566 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccc |
50714484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 74; E-Value: 9e-34
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 9289639 - 9289558
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
9289639 |
ggcttaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccc |
9289558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 155 - 238
Target Start/End: Original strand, 50714238 - 50714321
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
50714238 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctggtaaaaaaaaaattgtttttggtccc |
50714321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 71; E-Value: 6e-32
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 9289266 - 9289348
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt-aaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
9289266 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaaaaaaaaaattgtttttggtccc |
9289348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 41345853 - 41345935
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt-aaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
41345853 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaaattgtttttggtccc |
41345935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 150 - 238
Target Start/End: Original strand, 123527 - 123616
Alignment:
| Q |
150 |
ttaaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt-aaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
123527 |
ttaaataggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctggtaaaaaaaaaaattgtttttggtccc |
123616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 13479611 - 13479531
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||| |||||||||||||| |
|
|
| T |
13479611 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccct-gtaaaaaaaaatttgtttttggtccc |
13479531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 23778964 - 23779045
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||| | ||||||| |||||||||||||||||||| |
|
|
| T |
23778964 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcttggtaaaaaaaaaattgtttttggtccc |
23779045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 32208542 - 32208622
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
32208542 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctagtaaa-aaaaaattgtttttggtccc |
32208622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 51709027 - 51708946
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
51709027 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtctctggtaaaaaaaaaattgtttttggtccc |
51708946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 157 - 240
Target Start/End: Complemental strand, 8760781 - 8760698
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtcccaa |
240 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |||||||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
8760781 |
ggctaaaatatggttttagtccttgcaaatatggctcgttttggttttagtccctgtaaaaaaaaaaattgtttttggtcccaa |
8760698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 159 - 238
Target Start/End: Original strand, 43368467 - 43368545
Alignment:
| Q |
159 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
43368467 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccct-gtaaaaaaaaaattgtttttggtccc |
43368545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 6827874 - 6827792
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaa-ttgtttttggtccc |
238 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
6827874 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaatttgtttttggtccc |
6827792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 160 - 238
Target Start/End: Original strand, 38054549 - 38054626
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
38054549 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct-gtaaaaaaaaaattgtttttggtccc |
38054626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 160 - 238
Target Start/End: Complemental strand, 51545966 - 51545889
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
51545966 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct-gtaaaaaaaaaattgtttttggtccc |
51545889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 18205156 - 18205236
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
18205156 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct-ataaaaaaaaaattgtttttggtccc |
18205236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 29463913 - 29463832
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| ||||||| ||| |||||||||||||||||||| |
|
|
| T |
29463913 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttggtccctgtaaaaaaaaaaattgtttttggtccc |
29463832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 32365094 - 32365175
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||| |||| ||| |||||||||||||||||||| |
|
|
| T |
32365094 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtgaaaaaaaaaattgtttttggtccc |
32365175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 32365483 - 32365403
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||| || || |||||||||||||||||||| |
|
|
| T |
32365483 |
ggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtccct-gtgaaaaaaaaattgtttttggtccc |
32365403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 34361803 - 34361883
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||| ||||||||||||||| |||| |
|
|
| T |
34361803 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt-ccttgtaaaaaaaaaattgtttttgatccc |
34361883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 41346218 - 41346137
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||| ||||||| ||||||||||| |
|
|
| T |
41346218 |
ggctaaaatatggttttagtccctgcaaatatgtctcattttggttttagtccttggtaaaaaaaaaatcatttttggtccc |
41346137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 45593586 - 45593506
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||| ||| ||||| |||||||||||||||||||| |
|
|
| T |
45593586 |
ggctaaaatatggttttagtctctgcaaatatgtctcgttttggttttagttcct-gtaaaaaaaaaattgtttttggtccc |
45593506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 52430100 - 52430021
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
52430100 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtccct-gtaaa-aaaaaattgtttttggtccc |
52430021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 52442092 - 52442013
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
52442092 |
ggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccct-gtaaa-aaaaaattgtttttggtccc |
52442013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 155 - 238
Target Start/End: Complemental strand, 35415635 - 35415551
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaa-aattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
35415635 |
ttggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaatttttgtttttggtccc |
35415551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 151 - 238
Target Start/End: Original strand, 52441757 - 52441841
Alignment:
| Q |
151 |
taaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
52441757 |
taaataggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccct-gtaa--aaaaaattgtttttggtccc |
52441841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 157 - 236
Target Start/End: Complemental strand, 16712691 - 16712614
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtc |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
16712691 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct-gtaaa-aaaaaattgtttttggtc |
16712614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 159 - 238
Target Start/End: Complemental strand, 18831176 - 18831098
Alignment:
| Q |
159 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
18831176 |
ctaaaatatggttttagtccctgtaaatatgtcttgttttggttttagtccct-gtaaaaaaaaaattgtttttggtccc |
18831098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 157 - 224
Target Start/End: Complemental strand, 24474963 - 24474896
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaa |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
24474963 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctagtaaaaaaaaaa |
24474896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 155 - 238
Target Start/End: Original strand, 28809009 - 28809091
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||||||||||||||||||| ||||| ||||||||||||||| |||| |
|
|
| T |
28809009 |
ttggctaaaatatggttttagtccttgcaaatatgtatcgttttggttttagtccct-gtaaaaaaaaaattgtttttgatccc |
28809091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 157 - 224
Target Start/End: Original strand, 35763647 - 35763714
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaa |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
35763647 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaa |
35763714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 160 - 238
Target Start/End: Original strand, 41619902 - 41619981
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaa-attgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
41619902 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaattttgtttttggtccc |
41619981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 145 - 238
Target Start/End: Original strand, 51708680 - 51708777
Alignment:
| Q |
145 |
atattttaaatt-ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt---aaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||| ||| |||||||||||||||||||| |
|
|
| T |
51708680 |
atatttgaaattaggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtctctggtaaaaaaaaaaaaattgtttttggtccc |
51708777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 6827546 - 6827628
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaa-ttgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |||||||||||||||||| |||||||| |||||| |||||||||||||| |
|
|
| T |
6827546 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtcgctggtaaaaaaaaaatttgtttttggtccc |
6827628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 35415299 - 35415381
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt-aaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
35415299 |
ggctaaaatatggttttagtccctgtaaatatgcatcgttttggttttagtccctggtaaaaaaaaaaattgtttttggtccc |
35415381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 41620256 - 41620174
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt-aaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
41620256 |
ggctaaaatatggttttagtccctgtaaatatgcatcgttttggttttagtccctggtaaaaaaaaaaattgtttttggtccc |
41620174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 4279022 - 4279103
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
4279022 |
ggctaaaatatggttttagcccctgcaaatatatctcgttttggttttagtccctgtataaaaaaaaattgtttttggtccc |
4279103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 8760604 - 8760683
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||| |||||| |||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
8760604 |
ggctaaaatatagttttactccctgcaaatatgtctcgttttggttttagtccct-gtaaa-aaaaaattgtttttggtccc |
8760683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 9446323 - 9446243
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||||||||||||||||| |||||| ||||| |||||||||||||||||||| |
|
|
| T |
9446323 |
ggctaaaatatgattttagtccctgtaaatatgtctcgttttggttttcgtccct-gtaaaaaaaaaattgtttttggtccc |
9446243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 158 - 235
Target Start/End: Original strand, 11285504 - 11285581
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggt |
235 |
Q |
| |
|
||||||||||| |||||||||||||||||||| |||||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
11285504 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaaattgtttttggt |
11285581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 13064159 - 13064238
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||| ||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
13064159 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccct-gtaaa-aaaaaattgtttttggtccc |
13064238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 157 - 237
Target Start/End: Complemental strand, 22099912 - 22099831
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaa-ttgtttttggtcc |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||| |||||| ||||||||||||| |
|
|
| T |
22099912 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtctctgtaaaaaaaaaaatttgtttttggtcc |
22099831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 41921084 - 41921003
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||||| |||||| ||||| |||||||||||||| |
|
|
| T |
41921084 |
ggctaaaatatggttttagcccctgcaaatatgtttcgttttggttttagtcctaggtaaaaaaaaatttgtttttggtccc |
41921003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 51545629 - 51545709
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||| || ||||| |||||||||||||||||||| |
|
|
| T |
51545629 |
ggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtctct-gtaaaaaaaaaattgtttttggtccc |
51545709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 53716921 - 53717001
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||| ||| ||||| |||||||||||| ||||||| |
|
|
| T |
53716921 |
ggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagt-ccttgtaaaaaaaaaattgtttctggtccc |
53717001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 157 - 237
Target Start/End: Original strand, 2180220 - 2180300
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtcc |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| ||| ||||||||| ||||||||| |
|
|
| T |
2180220 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaaaaaaaattggttttggtcc |
2180300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 158 - 238
Target Start/End: Original strand, 13479273 - 13479351
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||| |||||||||||||||||||| |
|
|
| T |
13479273 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttactccct-ataaa-aaaaaattgtttttggtccc |
13479351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 157 - 213
Target Start/End: Complemental strand, 46088060 - 46088004
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46088060 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
46088004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 159 - 238
Target Start/End: Original strand, 9445951 - 9446028
Alignment:
| Q |
159 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||| |||||||||||||||||||| ||||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
9445951 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccct-gtaaa-aaaaaattgtttttggtccc |
9446028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 157 - 236
Target Start/End: Original strand, 22584287 - 22584365
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtc |
236 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||| || ||||| |||| ||||||||||||| |
|
|
| T |
22584287 |
ggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtctct-gtaaaaaaaatattgtttttggtc |
22584365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 162 - 237
Target Start/End: Complemental strand, 27008401 - 27008327
Alignment:
| Q |
162 |
aaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtcc |
237 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||||||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
27008401 |
aaatatggttttagtctctgcaaatatgcctcgttttggttttagtccct-gtaaaaaaaaaattgtttttggtcc |
27008327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 156 - 238
Target Start/End: Original strand, 27008083 - 27008164
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |||||||||||||||||||||| |||| |||||| |||||||||||| |
|
|
| T |
27008083 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgttaaa-aaaaaaaagtttttggtccc |
27008164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 157 - 231
Target Start/End: Original strand, 45505600 - 45505674
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttt |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || ||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
45505600 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctgtgaaaaaaaaaattgtttt |
45505674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 146 - 212
Target Start/End: Original strand, 46115403 - 46115469
Alignment:
| Q |
146 |
tattttaaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||| |||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
46115403 |
tattttatattggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
46115469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 146 - 212
Target Start/End: Original strand, 46128537 - 46128603
Alignment:
| Q |
146 |
tattttaaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||| |||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
46128537 |
tattttatattggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
46128603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 5052584 - 5052504
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| ||||||||||||||||| ||| ||||| |||||||||||||| ||||| |
|
|
| T |
5052584 |
ggctacaatatggttttagtccctgcaaatatgcctcgttttggttttagt-ccttgtaaaaaaaaaattgtttttagtccc |
5052504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 5882552 - 5882630
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
5882552 |
ggctaaaatatggttttagtcc-tgcaaatatgcctcgttttggttttagtccct-gtaaa-aaaaaattgtttttggtccc |
5882630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 13073757 - 13073814
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13073757 |
ttggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
13073814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 160 - 217
Target Start/End: Original strand, 15555506 - 15555563
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
15555506 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaa |
15555563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 157 - 229
Target Start/End: Original strand, 13631228 - 13631298
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtt |
229 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
13631228 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct-gtaaa-aaaaaattgtt |
13631298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 156 - 237
Target Start/End: Original strand, 22099542 - 22099624
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaa--ttgtttttggtcc |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||| ||| ||||| |||||| ||||||||||||| |
|
|
| T |
22099542 |
tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt-ccttgtaaaaaaaaaattttgtttttggtcc |
22099624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 29380910 - 29380858
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29380910 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
29380858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 157 - 229
Target Start/End: Original strand, 35464018 - 35464088
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtt |
229 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
35464018 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct-gtaaa-aaaaaattgtt |
35464088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 156 - 212
Target Start/End: Complemental strand, 53717175 - 53717119
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
53717175 |
tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
53717119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 155 - 235
Target Start/End: Complemental strand, 55482470 - 55482392
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggt |
235 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||| ||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
55482470 |
ttggctaaaatatgattttagtccctccaaatatgcctcgttttggttttagtccct-gtaaa-aaaaaattgtttttggt |
55482392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 155 - 238
Target Start/End: Complemental strand, 2180574 - 2180492
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| | ||||||||||||||| ||| ||||| |||||||| ||||||||||| |
|
|
| T |
2180574 |
ttggctaaaatatagttttagtccctgcaaatatggcacgttttggttttagt-ccttgtaaaaaaaaaattatttttggtccc |
2180492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 13064465 - 13064410
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
13064465 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
13064410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 14791806 - 14791751
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14791806 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
14791751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 154 - 229
Target Start/End: Complemental strand, 19321862 - 19321789
Alignment:
| Q |
154 |
attggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtt |
229 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
19321862 |
attggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccct-gtaaa-aaaaaattgtt |
19321789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 25423924 - 25423979
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25423924 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
25423979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 25424312 - 25424257
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25424312 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
25424257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 142 - 213
Target Start/End: Original strand, 29380653 - 29380724
Alignment:
| Q |
142 |
ttcatattttaaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
||||| ||||||| ||||||||||| |||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
29380653 |
ttcattttttaaaaaggctaaaatatagttttagtccctgcaaatatgtctcgttttggttttggtccctgg |
29380724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 36702000 - 36702055
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
36702000 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
36702055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 43231088 - 43231143
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43231088 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
43231143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 46115779 - 46115724
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
46115779 |
ggctaaaatatggttttagtccctgcaaatacgtctcgttttggttttagtccctg |
46115724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 46128913 - 46128858
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
46128913 |
ggctaaaatatggttttagtccctgcaaatacgtctcgttttggttttagtccctg |
46128858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 52017505 - 52017560
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
52017505 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
52017560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 52017870 - 52017815
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
52017870 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
52017815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 157 - 211
Target Start/End: Complemental strand, 29420537 - 29420483
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccct |
211 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29420537 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
29420483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 147 - 229
Target Start/End: Complemental strand, 31560705 - 31560625
Alignment:
| Q |
147 |
attttaaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtt |
229 |
Q |
| |
|
||||| || |||||||||||||||||| ||||||||||||||||||| ||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
31560705 |
atttttaaatggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccct-gtaaa-aaaaaattgtt |
31560625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 32208901 - 32208822
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||| ||||||||||| |||| |||||| ||||||||||||| |
|
|
| T |
32208901 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttgattttagtccctagtaa--aaaaaaatgtttttggtccc |
32208822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 156 - 238
Target Start/End: Complemental strand, 53308069 - 53307987
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |||||||||||||||||||| ||| ||| |||||||||||||| |
|
|
| T |
53308069 |
tggctaaaatatggttttggtccctgcaaatatgtcccgttttggttttagtccctgtaaaaaaaattgttgtttttggtccc |
53307987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 5827653 - 5827710
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
5827653 |
ttggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
5827710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 159 - 212
Target Start/End: Complemental strand, 18205521 - 18205468
Alignment:
| Q |
159 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
18205521 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
18205468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 23245229 - 23245286
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
23245229 |
ttggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
23245286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 26412586 - 26412529
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
26412586 |
ttggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg |
26412529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 35464384 - 35464327
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
35464384 |
ttggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
35464327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 152 - 212
Target Start/End: Complemental strand, 11693126 - 11693066
Alignment:
| Q |
152 |
aaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
11693126 |
aaataggctaaaatatggttttggtccctgcaaatatgtctcgttttgattttagtccctg |
11693066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 145 - 212
Target Start/End: Complemental strand, 13530723 - 13530658
Alignment:
| Q |
145 |
atattttaaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||| ||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
13530723 |
atattttaaa--ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
13530658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 157 - 229
Target Start/End: Complemental strand, 23245595 - 23245525
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtt |
229 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
23245595 |
ggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccct-gtaaa-aaaaaattgtt |
23245525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 152 - 224
Target Start/End: Complemental strand, 34355288 - 34355216
Alignment:
| Q |
152 |
aaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaa |
224 |
Q |
| |
|
|||| |||||||||||||||||||||||| ||||||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
34355288 |
aaataggctaaaatatggttttagtccctcaaaatatgactcgttttggttttagtccctgtaaaataaaaaa |
34355216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 157 - 229
Target Start/End: Original strand, 42848027 - 42848097
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtt |
229 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
42848027 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtccct-gtaaa-aaaaaattgtt |
42848097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 156 - 212
Target Start/End: Complemental strand, 42848392 - 42848336
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
42848392 |
tggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
42848336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 146 - 238
Target Start/End: Complemental strand, 43368788 - 43368697
Alignment:
| Q |
146 |
tattttaaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||| ||||||||||||||||||| | || |||||||||| |||||||||||||||| ||| ||||| ||||||||||||||| |||| |
|
|
| T |
43368788 |
tattttaatatggctaaaatatggttttaattccggcaaatatgtttcgttttggttttagttcct-gtaaaaaaaaaattgtttttgatccc |
43368697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 152 - 212
Target Start/End: Complemental strand, 53916052 - 53915992
Alignment:
| Q |
152 |
aaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
53916052 |
aaataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg |
53915992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 55072389 - 55072471
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaa--ttgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||| | |||| |||||||||||||| |
|
|
| T |
55072389 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccct-gtaaaaagaaaattttgtttttggtccc |
55072471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 2034855 - 2034800
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
2034855 |
ggctaaaatatggttttagtcccagcaaatatgcctcgttttggttttagtccctg |
2034800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 5827973 - 5827918
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
5827973 |
ggctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtccctg |
5827918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 12152493 - 12152438
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
12152493 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttggtccctg |
12152438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 13631599 - 13631544
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
13631599 |
ggctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtccctg |
13631544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 13764613 - 13764668
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
13764613 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttaagtccctg |
13764668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #102
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 14488187 - 14488132
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
14488187 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
14488132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #103
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 23779225 - 23779170
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
23779225 |
ggctaaaatatggttttaatccctgcaaatatgtctcattttggttttagtccctg |
23779170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #104
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 24774045 - 24774100
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
24774045 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
24774100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #105
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 26412190 - 26412245
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26412190 |
ggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
26412245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #106
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 29499182 - 29499237
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
29499182 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
29499237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #107
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 30046792 - 30046737
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
30046792 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
30046737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #108
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 30061133 - 30061078
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
30061133 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
30061078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #109
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 31812213 - 31812158
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
31812213 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtccctg |
31812158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #110
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 216
Target Start/End: Complemental strand, 35763955 - 35763896
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaa |
216 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
35763955 |
ggctaaaatatgattttagtccctgcagatatgcctcgttttggttttagtccctggtaa |
35763896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #111
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 43231389 - 43231334
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
43231389 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
43231334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #112
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 45505894 - 45505839
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
45505894 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg |
45505839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #113
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 159 - 238
Target Start/End: Original strand, 51830891 - 51830968
Alignment:
| Q |
159 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||| ||||||||||||||| |||||||| |||||||||||||||||| ||||| ||||||||||||||| |||| |
|
|
| T |
51830891 |
ctaaaatatagttttagtccctgcatatatgtcttgttttggttttagtccct-gtaaa-aaaaaattgtttttgatccc |
51830968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #114
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 153 - 226
Target Start/End: Original strand, 5202922 - 5202996
Alignment:
| Q |
153 |
aattggctaaaatatggttttagtccctgcaaatatgtctcg-ttttggttttagtccctggtaaataaaaaatt |
226 |
Q |
| |
|
|||||| |||||||||||||| ||||||||||||||| |||| ||||||||||||||||| ||||| |||||||| |
|
|
| T |
5202922 |
aattggttaaaatatggttttggtccctgcaaatatgcctcgtttttggttttagtccctagtaaaaaaaaaatt |
5202996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #115
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 158 - 208
Target Start/End: Complemental strand, 15555637 - 15555587
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15555637 |
gctaaaatatagttttagtccctgcaaatatgtctcgttttggttttagtc |
15555587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #116
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 159 - 209
Target Start/End: Complemental strand, 19903653 - 19903603
Alignment:
| Q |
159 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
19903653 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
19903603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #117
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 22584607 - 22584529
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||| |||||||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
22584607 |
ggctaaaatgtggttttagtctctgcaaatatgcttcgttttggttttagtccct-gtaa--aaaaaattgtttttggtccc |
22584529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #118
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 157 - 211
Target Start/End: Complemental strand, 28809180 - 28809126
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccct |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
28809180 |
ggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccct |
28809126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #119
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 158 - 212
Target Start/End: Original strand, 36050289 - 36050343
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
36050289 |
gctaaaatatggttttggtccccgcaaatatgtctcgttttggttttagtccctg |
36050343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #120
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 155 - 238
Target Start/End: Complemental strand, 41324892 - 41324807
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaa--ttgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||| || ||||||||||| |||||||||||||||||||||| ||| |||||| |||||||||||||| |
|
|
| T |
41324892 |
ttggctaaaatatggttttgatctctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaaatgttgtttttggtccc |
41324807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #121
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 156 - 209
Target Start/End: Complemental strand, 4279336 - 4279283
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
4279336 |
tggctaaaatatgattttagtccctgcaaatatggctcgttttggttttagtcc |
4279283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #122
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 8191393 - 8191336
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| ||||| |||||||| |
|
|
| T |
8191393 |
ttggctaaaatatggttttagtccctgcaaatatgcctcgtttcggtttcagtccctg |
8191336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #123
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 25358542 - 25358485
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||| |||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
25358542 |
ttggctaaaatatgattttggtccctgtaaatatgtctcgttttggttttagtccctg |
25358485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #124
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 159 - 212
Target Start/End: Original strand, 30564835 - 30564888
Alignment:
| Q |
159 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
30564835 |
ctaaaatatggttttagtccctgcaaatatgttttgttttggttttagtccctg |
30564888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #125
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 158 - 238
Target Start/End: Complemental strand, 36702362 - 36702281
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaa-ataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||| |||||| ||||| |||||||||||||||||||||| || | ||||| |||||||||||||| |
|
|
| T |
36702362 |
gctaaaatatggttttagttcctgcagatatgcctcgttttggttttagtccctgtaaagagaaaaatttgtttttggtccc |
36702281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #126
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 45593228 - 45593307
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||| |||||||||||| |||||||| |||||||||| |||||||||| ||||| ||||||| |||||||||||| |
|
|
| T |
45593228 |
ggctaaaatatagttttagtccctacaaatatgcctcgttttggctttagtccct-gtaaa-aaaaaatagtttttggtccc |
45593307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #127
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 148 - 212
Target Start/End: Complemental strand, 47023115 - 47023050
Alignment:
| Q |
148 |
ttttaaatt-ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||| ||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
47023115 |
ttttaaattaggctaaaatatggttttgatccctgcaaatatgtttcgttttggttttagtccctg |
47023050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #128
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 157 - 213
Target Start/End: Original strand, 4211561 - 4211617
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
4211561 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctgg |
4211617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #129
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 152 - 212
Target Start/End: Original strand, 13530374 - 13530434
Alignment:
| Q |
152 |
aaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||||||||||||||||| |||||||||||| |
|
|
| T |
13530374 |
aaataggctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtccctg |
13530434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #130
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 157 - 229
Target Start/End: Original strand, 14487802 - 14487872
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtt |
229 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||| |||||| ||||| ||||||||||| |
|
|
| T |
14487802 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccct-gtaaa-aaaaaattgtt |
14487872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #131
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 160 - 212
Target Start/End: Complemental strand, 29499543 - 29499491
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
29499543 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
29499491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #132
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 156 - 212
Target Start/End: Original strand, 46292391 - 46292447
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
46292391 |
tggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctg |
46292447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #133
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 155 - 207
Target Start/End: Complemental strand, 47274232 - 47274180
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
207 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
47274232 |
ttggctaaaatatagttttagttcctgcaaatatgtctcgttttggttttagt |
47274180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #134
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 157 - 229
Target Start/End: Original strand, 51738137 - 51738207
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtt |
229 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||||||||||||||||| ||||| ||||| ||||||||||| |
|
|
| T |
51738137 |
ggctaaaatatggttttggtccctacaaatatgtctcgttttggttttactccct-gtaaa-aaaaaattgtt |
51738207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #135
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 160 - 208
Target Start/End: Complemental strand, 54208822 - 54208774
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
54208822 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
54208774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #136
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 160 - 212
Target Start/End: Complemental strand, 55072709 - 55072657
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
55072709 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctg |
55072657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #137
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 162 - 224
Target Start/End: Complemental strand, 123893 - 123830
Alignment:
| Q |
162 |
aaatatggttttagtccctgcaaatatgtctcgttttggttttagt-ccctggtaaataaaaaa |
224 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| ||||||||||||| |||||||||| |||||| |
|
|
| T |
123893 |
aaatatggttttagtccctgcaaatatgcctcattttggttttagtcccctggtaaaaaaaaaa |
123830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #138
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 2322432 - 2322377
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2322432 |
ggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtgcctg |
2322377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #139
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 12791974 - 12791919
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
12791974 |
ggctaaaatatgatttttgtccctgcaaatatgcctcgttttggttttagtccctg |
12791919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #140
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 26314332 - 26314277
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||||||||||||||||||||||| |
|
|
| T |
26314332 |
ggctaaaatatggttttgatccctgaaaatatgtctcgttttggttttagtccctg |
26314277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #141
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 27427872 - 27427926
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
27427872 |
ggctaaaatatggttt-agtccctgcaaatatggctcgttttggttttagtccctg |
27427926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #142
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 31182504 - 31182449
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||||||||||||||| |||||||| |
|
|
| T |
31182504 |
ggctaaaatatggttttaattcctgcaaatatgtctcgttttggtttcagtccctg |
31182449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #143
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 31811925 - 31811980
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
31811925 |
ggctaaaatatggttttgatccctgcaaatatgtatcgttttggttttagtccctg |
31811980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #144
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 42823776 - 42823831
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42823776 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtacctg |
42823831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #145
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 208
Target Start/End: Original strand, 44925485 - 44925536
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
44925485 |
ggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtc |
44925536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #146
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 208
Target Start/End: Complemental strand, 46292651 - 46292600
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
46292651 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtc |
46292600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #147
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 160 - 211
Target Start/End: Original strand, 47022743 - 47022794
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccct |
211 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
47022743 |
taaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccct |
47022794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #148
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 158 - 209
Target Start/End: Complemental strand, 47136170 - 47136119
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
47136170 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
47136119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #149
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 53915683 - 53915738
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
53915683 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctg |
53915738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #150
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 54903475 - 54903420
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
54903475 |
ggctaaaatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
54903420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #151
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 158 - 212
Target Start/End: Complemental strand, 6353637 - 6353583
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
6353637 |
gctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtccctg |
6353583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #152
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 153 - 238
Target Start/End: Original strand, 16712325 - 16712413
Alignment:
| Q |
153 |
aattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg---gtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||| |||||||||||||||| |||||||||||||| ||||||||||| |||||| ||| ||| |||||||||||||||||||| |
|
|
| T |
16712325 |
aattgactaaaatatggttttaatccctgcaaatatgcctcgttttggtattagtctctgtaaaaaaaaaaaaaattgtttttggtccc |
16712413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #153
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 147 - 209
Target Start/End: Complemental strand, 35119621 - 35119559
Alignment:
| Q |
147 |
attttaaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
|||||| || ||||||||||||||||| ||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
35119621 |
attttatataggctaaaatatggttttggtcactgcaaatatgtctcgttttggtttcagtcc |
35119559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #154
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 155 - 225
Target Start/End: Original strand, 41920766 - 41920836
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaat |
225 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||| ||||| ||||||| |||||||| ||||||| |
|
|
| T |
41920766 |
ttggttaaaatatggttttagtccctgcaaatatgactcattttgattttagtttctggtaaaaaaaaaat |
41920836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #155
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 155 - 209
Target Start/End: Complemental strand, 42824093 - 42824039
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| |||||| ||||||||| |
|
|
| T |
42824093 |
ttggctaaaatatggttttggtccctgcaaatatgtcttgttttgattttagtcc |
42824039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #156
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 5797479 - 5797536
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||| ||||||||| |||| ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
5797479 |
ttggttaaaatatgattttggtctctgcaaatatgtctcgttttggttttagtccctg |
5797536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #157
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 26313986 - 26314043
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
26313986 |
ttggctaaaatatggttttgatccctgcaaatatgttccgttttggttttagtccctg |
26314043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #158
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 159 - 212
Target Start/End: Complemental strand, 35420701 - 35420648
Alignment:
| Q |
159 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
35420701 |
ctaaaatatggttttggtccttgcaaatatgtctcgatttggttttagtccctg |
35420648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #159
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 45474596 - 45474516
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||||||||||| || ||||| |||||| | |||||| |||| |
|
|
| T |
45474596 |
ggctaaaatatggttttagtccctgcaaatatgcttcgctttggttttagtctct-gtaaaaaaaaaaatatttttgatccc |
45474516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #160
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 160 - 212
Target Start/End: Complemental strand, 5797817 - 5797765
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
5797817 |
taaaatatggttttggtccctacaaatatgtctcgttttggttttaatccctg |
5797765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #161
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 158 - 238
Target Start/End: Original strand, 7639897 - 7639975
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||||| |||||||||||| || || ||||| ||||||||| |||||||||| |
|
|
| T |
7639897 |
gctaaaatatggttttggtccctacaaatatgtcttgttttggttttaatctct-gtaaa-aaaaaattggttttggtccc |
7639975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #162
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 13074125 - 13074073
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
13074125 |
ggctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtcc |
13074073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #163
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 13764807 - 13764755
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||| |||||||||||||||||| |
|
|
| T |
13764807 |
ggctaaaatatggttttggtccctgtaaatatgtttcgttttggttttagtcc |
13764755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #164
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 14594206 - 14594258
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
14594206 |
ggctaaaatatggttttggtccctgcaaatatgtctcactttggttttagtcc |
14594258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #165
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 152 - 208
Target Start/End: Original strand, 20291981 - 20292037
Alignment:
| Q |
152 |
aaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
|||| |||||||||||| |||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
20291981 |
aaataggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtc |
20292037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #166
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 160 - 212
Target Start/End: Original strand, 30060772 - 30060824
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
30060772 |
taaaatatggttttggtccctgcaaatatgcctcgttttgtttttagtccctg |
30060824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #167
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 157 - 205
Target Start/End: Original strand, 52543422 - 52543470
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
205 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
52543422 |
ggctaaaatatggttttggtccttgcaaatatgtctcgttttggtttta |
52543470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #168
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 12152154 - 12152209
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
12152154 |
ggctaaaatatggttttggtccctgcaaatatgactcgtttaagttttagtccctg |
12152209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #169
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 155 - 226
Target Start/End: Original strand, 22204053 - 22204124
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaatt |
226 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||| | |||| ||||||||||||||||||| |||||||| |
|
|
| T |
22204053 |
ttggctaaaatatgtttttggtccctgcaaatatagcgagtttgggttttagtccctggtaaaaaaaaaatt |
22204124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #170
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 157 - 208
Target Start/End: Original strand, 28448834 - 28448885
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
|||||||||||||||||||||| | |||||||| |||||||||||||||||| |
|
|
| T |
28448834 |
ggctaaaatatggttttagtccttacaaatatgcctcgttttggttttagtc |
28448885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #171
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 31560331 - 31560386
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
31560331 |
ggctaaaatatggttttgatccctgcaaatatgcttcgttttggttttagtccctg |
31560386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #172
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 35119292 - 35119347
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
35119292 |
ggctaaaatatggttttggtccctgcaaatatgctccgttttggttttagtccctg |
35119347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #173
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 36054150 - 36054095
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
36054150 |
ggctaaaatacggttttggtccctgcaaatatgcctcattttggttttagtccctg |
36054095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #174
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 162 - 229
Target Start/End: Complemental strand, 47532667 - 47532602
Alignment:
| Q |
162 |
aaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtt |
229 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||||||| ||| ||||| ||||||||||| |
|
|
| T |
47532667 |
aaatatggttttggtccttgcaaatatgtctcgttttggttttagttcct-gtaaa-aaaaaattgtt |
47532602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #175
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 162 - 212
Target Start/End: Original strand, 2034544 - 2034594
Alignment:
| Q |
162 |
aaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||| |||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2034544 |
aaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
2034594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #176
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 158 - 212
Target Start/End: Original strand, 2322094 - 2322148
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||| |||||| |||||||| ||||||||||||||||| |||| |
|
|
| T |
2322094 |
gctaaaatatggttttggtccctacaaatatgcctcgttttggttttagtacctg |
2322148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #177
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 164 - 238
Target Start/End: Complemental strand, 3653733 - 3653659
Alignment:
| Q |
164 |
atatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||| |||||||||||| |||||| || ||||||||||||||| | |||||| |||||||||||||| ||||| |
|
|
| T |
3653733 |
atatgattttagtccctgtaaatataccttgttttggttttagtctccggtaaaaaaaaaattgtttttagtccc |
3653659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #178
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 155 - 205
Target Start/End: Original strand, 29463608 - 29463658
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
205 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||| ||||||||||||||| |
|
|
| T |
29463608 |
ttggctaaaatatggttttatttcctgcaaatatgcctcgttttggtttta |
29463658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #179
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 157 - 235
Target Start/End: Original strand, 31370804 - 31370881
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggt |
235 |
Q |
| |
|
|||||||||||||||||||| |||| |||||| ||||||||||||||||| | ||||| ||||||||||||||||| |
|
|
| T |
31370804 |
ggctaaaatatggttttagtgtctgcgaatatgcctcgttttggttttagt-ttttgtaaaaaaaaaattgtttttggt |
31370881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #180
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 158 - 212
Target Start/End: Complemental strand, 37557194 - 37557140
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
37557194 |
gctaaaatatggttttggtccctgcaaatatacctcgttttgattttagtccctg |
37557140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #181
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 158 - 212
Target Start/End: Complemental strand, 44925844 - 44925790
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||| ||| | ||||||||| |||||||||||||||||||||| |
|
|
| T |
44925844 |
gctaaaatatggttttggtctccgcaaatatgcctcgttttggttttagtccctg |
44925790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #182
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 167 - 212
Target Start/End: Complemental strand, 25358499 - 25358454
Alignment:
| Q |
167 |
tggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| | ||||||| |
|
|
| T |
25358499 |
tggttttagtccctgcaaatatgtctcgttttggttgtggtccctg |
25358454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #183
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 157 - 205
Target Start/End: Original strand, 8904886 - 8904934
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
205 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
8904886 |
ggctaaaatatagttttggtccctgcaaatatgcctcgttttggtttta |
8904934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #184
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 160 - 208
Target Start/End: Original strand, 14791502 - 14791550
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
14791502 |
taaaatatggttttggtccctgcaaatatgcctcattttggttttagtc |
14791550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #185
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 152 - 212
Target Start/End: Original strand, 19903256 - 19903316
Alignment:
| Q |
152 |
aaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||| ||||||||||| ||||| |||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
19903256 |
aaataggctaaaatatagttttgatccctgcaaatatgtctcattttgattttagtccctg |
19903316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #186
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 160 - 212
Target Start/End: Original strand, 20144423 - 20144475
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||| ||||||| ||||| |
|
|
| T |
20144423 |
taaaatatggttttggtccctgcaaatatgcctcgttttagttttagaccctg |
20144475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #187
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 24474600 - 24474651
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
24474600 |
ggctaaaatatggttttagtcc-tgcaaatatgcatcgttttggttttagtcc |
24474651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #188
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 157 - 205
Target Start/End: Complemental strand, 28449214 - 28449166
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
205 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||||||||| ||||| |
|
|
| T |
28449214 |
ggctaaaatatggttttggtccttgcaaatatgtctcgttttgatttta |
28449166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #189
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 160 - 233
Target Start/End: Original strand, 34354972 - 34355041
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttg |
233 |
Q |
| |
|
|||||||| ||||||||||||||| || |||||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
34354972 |
taaaatatagttttagtccctgca----tgcctcgttttggttttagtccctgtaaaaaaaaaaattgtttttg |
34355041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #190
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 160 - 212
Target Start/End: Original strand, 50753925 - 50753977
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||| |||||||||||||| |||| |
|
|
| T |
50753925 |
taaaatatggttttggtccctgcaaatatatcttgttttggttttagttcctg |
50753977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #191
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 160 - 212
Target Start/End: Original strand, 50822013 - 50822065
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||||||||| ||||||| || |||||||||||||||||| |
|
|
| T |
50822013 |
taaaatatggttttagtccctgtaaatatgattcattttggttttagtccctg |
50822065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #192
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 160 - 238
Target Start/End: Original strand, 5063013 - 5063087
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||| ||||||||||||||||||| || |||||||||| ||||||| |||| |||||||||||||||||||| |
|
|
| T |
5063013 |
taaaatatg-ttttagtccctgcaaatataccttgttttggtttaagtccct-gtaa--aaaaaattgtttttggtccc |
5063087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #193
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 7642652 - 7642597
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||| || | ||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
7642652 |
ggctaaaatatgattatggtctctgcaaatatgtttcgttttggttttagtccctg |
7642597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #194
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 18136113 - 18136058
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||| |||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
18136113 |
ggctaaaatatgactttaatccctacaaatatgcctcgttttggttttagtccctg |
18136058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #195
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 19321570 - 19321625
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||| |||| ||||||| ||| ||| |||||||||||||||||||||| |
|
|
| T |
19321570 |
ggctaaaatatgattttggtccctgtaaacatgcctcgttttggttttagtccctg |
19321625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #196
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 160 - 211
Target Start/End: Complemental strand, 28197278 - 28197227
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccct |
211 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||| || |||||||||||| |
|
|
| T |
28197278 |
taaaatatggttttagtctctacaaatatgtctcgtctttgttttagtccct |
28197227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #197
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 37556841 - 37556896
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||||| || ||||||||| |||| ||||||||||||||||| |
|
|
| T |
37556841 |
ggctaaaatatggttttagaccttgcaaatatacctcgatttggttttagtccctg |
37556896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #198
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 49123321 - 49123266
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||| |||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
49123321 |
ggctaaaatatgactttaatccctacaaatatgcctcgttttggttttagtccctg |
49123266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #199
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 50822294 - 50822239
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||| | ||| |||||||||||| |
|
|
| T |
50822294 |
ggctaaaatatggttttactccatgcaaatatgtctcatgttgattttagtccctg |
50822239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #200
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 51738411 - 51738356
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| |||| |||||||||| ||||||||| |||| ||||||| |
|
|
| T |
51738411 |
ggctaaaatatggttttggtccatgcaaatatgcctcgttttgattttggtccctg |
51738356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #201
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 158 - 212
Target Start/End: Original strand, 8191076 - 8191130
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||| ||||| ||||| ||||||||||| ||||| ||||||||||||| |
|
|
| T |
8191076 |
gctaaaatatgattttaatccctacaaatatgtcttgttttagttttagtccctg |
8191130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #202
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 157 - 211
Target Start/End: Original strand, 11692762 - 11692816
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccct |
211 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||| | ||||||| ||||||||||| |
|
|
| T |
11692762 |
ggctaaaatgtggttttggtccctgcaaatatgccccgttttgattttagtccct |
11692816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #203
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 170 - 212
Target Start/End: Original strand, 20144492 - 20144534
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
20144492 |
ttttggtccctgcaaatatgtctcgttttggttttggtccctg |
20144534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #204
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 158 - 212
Target Start/End: Complemental strand, 51763201 - 51763147
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||| ||| ||||||||||||| |||| |
|
|
| T |
51763201 |
gctaaaatatagttttggtccctgcaaatatgcctcattttggttttagttcctg |
51763147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #205
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 170 - 211
Target Start/End: Complemental strand, 14594494 - 14594453
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccct |
211 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
14594494 |
ttttggtccctgcaaatatgtctcgttttggttttggtccct |
14594453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #206
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 20144731 - 20144650
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||| || | |||||||||| ||||||||||||||| ||||| ||| ||| |||||||||||||| |
|
|
| T |
20144731 |
ggctaaaatatggttttggttcatgcaaatatgcctcgttttggttttaacccctgtaaaaaaaattgttgtttttggtccc |
20144650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #207
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 159 - 212
Target Start/End: Original strand, 35420393 - 35420446
Alignment:
| Q |
159 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||| ||||| ||||||||| | ||||||||||||||||||| |
|
|
| T |
35420393 |
ctaaaatatggttttggtccccgcaaatatgctttgttttggttttagtccctg |
35420446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #208
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 170 - 211
Target Start/End: Complemental strand, 54903403 - 54903362
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccct |
211 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
54903403 |
ttttggtccctgcaaatatgtctcgttttggttttggtccct |
54903362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #209
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 170 - 210
Target Start/End: Complemental strand, 2034781 - 2034741
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccc |
210 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
2034781 |
ttttggtccctgcaaatatgtctcattttggttttagtccc |
2034741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #210
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 155 - 211
Target Start/End: Complemental strand, 8905236 - 8905180
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccct |
211 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||| ||| ||||| ||||| ||||| |
|
|
| T |
8905236 |
ttggctaaaatatggttttggtccctgtaaatatgcctcattttgattttaatccct |
8905180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #211
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 160 - 208
Target Start/End: Original strand, 41439790 - 41439838
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
|||||||||||||||| | ||| |||||| ||||||||||||||||||| |
|
|
| T |
41439790 |
taaaatatggttttagcctctgtaaatatttctcgttttggttttagtc |
41439838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #212
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 157 - 229
Target Start/End: Original strand, 51762870 - 51762940
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtt |
229 |
Q |
| |
|
|||||||||||||| || ||| ||||||||||| || ||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
51762870 |
ggctaaaatatggtattggtctctgcaaatatgcttcattttggttttagtccct-gtaaa-aaaaaattgtt |
51762940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #213
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 229
Target Start/End: Original strand, 54208477 - 54208531
Alignment:
| Q |
173 |
tagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtt |
229 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
54208477 |
tagtccctgcaaatatgcctcattttggttttagtccct-gtaaa-aaaaaattgtt |
54208531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #214
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Complemental strand, 2322359 - 2322316
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
2322359 |
ttttggtccctgcaaatatgtctcgttttggttttcgtctctgg |
2322316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #215
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 209
Target Start/End: Complemental strand, 8905162 - 8905123
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
8905162 |
ttttggtccctgcaaatatgtctcgttttggttttcgtcc |
8905123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #216
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 158 - 209
Target Start/End: Original strand, 12791610 - 12791661
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| | |||| |||||||||| |
|
|
| T |
12791610 |
gctaaaatatagttttagtccctgcaaatatgtgccattttcgttttagtcc |
12791661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #217
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 161 - 212
Target Start/End: Complemental strand, 14594561 - 14594510
Alignment:
| Q |
161 |
aaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||| ||||||||||| ||||||| ||| |||||||||||||| |||| |
|
|
| T |
14594561 |
aaaatatgattttagtccctccaaatatttcttgttttggttttagttcctg |
14594510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #218
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Complemental strand, 29499473 - 29499430
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
29499473 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgg |
29499430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #219
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 30060842 - 30060885
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
30060842 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgg |
30060885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #220
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Complemental strand, 35464309 - 35464266
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
35464309 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgg |
35464266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #221
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 36050359 - 36050402
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
36050359 |
ttttggtccctgcaaatatgcctcgttttggttttggtccctgg |
36050402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #222
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 160 - 238
Target Start/End: Original strand, 49123000 - 49123074
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||| || ||||||| |||||||||||||||||| ||||| |||||||| ||||||||||| |
|
|
| T |
49123000 |
taaaatatggttttagtcc-tgtaaatatgcttcgttttggttttagtcc--tgtaaa-aaaaaattatttttggtccc |
49123074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #223
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 53915756 - 53915799
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
53915756 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgg |
53915799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #224
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 170 - 212
Target Start/End: Complemental strand, 7642580 - 7642538
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
7642580 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
7642538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #225
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 170 - 212
Target Start/End: Original strand, 23245304 - 23245346
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
23245304 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
23245346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #226
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 170 - 212
Target Start/End: Complemental strand, 26412511 - 26412469
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
26412511 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
26412469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #227
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 170 - 212
Target Start/End: Original strand, 31560404 - 31560446
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
31560404 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
31560446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #228
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 170 - 212
Target Start/End: Complemental strand, 42848318 - 42848276
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
42848318 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
42848276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #229
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 170 - 212
Target Start/End: Original strand, 43231161 - 43231203
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
43231161 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
43231203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #230
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 157 - 227
Target Start/End: Original strand, 45618285 - 45618355
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattg |
227 |
Q |
| |
|
|||||| ||||| |||| |||||||||||||| | |||| |||||| |||||||||||| ||||||||| |
|
|
| T |
45618285 |
ggctaatatatgcttttggtccctgcaaatatagcgagtttgggttttggtccctggtaaaaaaaaaattg |
45618355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #231
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 170 - 212
Target Start/End: Complemental strand, 50754182 - 50754140
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
50754182 |
tttttgtccctgcaaatatgtcttgttttggttttggtccctg |
50754140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #232
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 160 - 209
Target Start/End: Original strand, 18135793 - 18135841
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
||||||||||||||||||| || ||||||| |||||||||||||||||| |
|
|
| T |
18135793 |
taaaatatggttttagtcc-tgtaaatatgcttcgttttggttttagtcc |
18135841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #233
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 176 - 213
Target Start/End: Original strand, 19903340 - 19903377
Alignment:
| Q |
176 |
tccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
19903340 |
tccctgcaaatatgtctcattttggttttggtccctgg |
19903377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #234
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 167 - 204
Target Start/End: Original strand, 43231189 - 43231226
Alignment:
| Q |
167 |
tggttttagtccctgcaaatatgtctcgttttggtttt |
204 |
Q |
| |
|
||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
43231189 |
tggttttggtccctgcaaatatgtctcattttggtttt |
43231226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #235
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 175 - 204
Target Start/End: Original strand, 53307832 - 53307861
Alignment:
| Q |
175 |
gtccctgcaaatatgtctcgttttggtttt |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
53307832 |
gtccctgcaaatatgtctcgttttggtttt |
53307861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #236
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 156 - 209
Target Start/End: Complemental strand, 55805089 - 55805036
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
|||||||||||| ||||| || | |||||||||| || |||||||||||||||| |
|
|
| T |
55805089 |
tggctaaaatatagttttggttcttgcaaatatgccttgttttggttttagtcc |
55805036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #237
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 176 - 212
Target Start/End: Original strand, 5827734 - 5827770
Alignment:
| Q |
176 |
tccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
5827734 |
tccctgaaaatatgtctcgttttggttttggtccctg |
5827770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #238
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 198 - 238
Target Start/End: Original strand, 18830887 - 18830926
Alignment:
| Q |
198 |
tggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
18830887 |
tggttttagtccctg-taaaaaaaaaattgtttttggtccc |
18830926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #239
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 156 - 188
Target Start/End: Complemental strand, 22205282 - 22205250
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatat |
188 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
22205282 |
tggctaaaatatgcttttagtccctgcaaatat |
22205250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #240
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 164 - 208
Target Start/End: Complemental strand, 27428195 - 27428151
Alignment:
| Q |
164 |
atatggttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
||||||||||| | |||||||||||||||| |||| ||||||||| |
|
|
| T |
27428195 |
atatggttttaatacctgcaaatatgtctcattttcgttttagtc |
27428151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #241
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 157 - 217
Target Start/End: Complemental strand, 33137287 - 33137227
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaa |
217 |
Q |
| |
|
|||||||||||| |||| ||||||||||||| | |||| ||||||||||||||||||| |
|
|
| T |
33137287 |
ggctaaaatatgtttttgatccctgcaaatatagcgagtttgggttttagtccctggtaaa |
33137227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #242
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 157 - 217
Target Start/End: Complemental strand, 45619790 - 45619730
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaa |
217 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| | |||| |||||| ||||||||||| |
|
|
| T |
45619790 |
ggctaaaatatgtttttagtccctgcaaatatagcgagtttaggttttgttccctggtaaa |
45619730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #243
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 160 - 188
Target Start/End: Complemental strand, 51831002 - 51830974
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatat |
188 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
51831002 |
taaaatatggttttagtccctgcaaatat |
51830974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 79; Significance: 1e-36; HSPs: 214)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 154 - 236
Target Start/End: Original strand, 26813863 - 26813945
Alignment:
| Q |
154 |
attggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtc |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
26813863 |
attggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtc |
26813945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 154 - 238
Target Start/End: Complemental strand, 5790902 - 5790818
Alignment:
| Q |
154 |
attggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
5790902 |
attggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgataaaaaaaaaattgtttttggtccc |
5790818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 74; E-Value: 9e-34
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 19184151 - 19184070
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
19184151 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccc |
19184070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 74; E-Value: 9e-34
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 37272102 - 37272021
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
37272102 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccc |
37272021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 74; E-Value: 9e-34
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 38980253 - 38980172
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
38980253 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccc |
38980172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 17541382 - 17541463
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
17541382 |
ggctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccc |
17541463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 17541776 - 17541695
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
17541776 |
ggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccttggtaaaaaaaaaattgtttttggtccc |
17541695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 38639412 - 38639492
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
38639412 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtctctggtaaa-aaaaaattgtttttggtccc |
38639492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 160 - 238
Target Start/End: Original strand, 17912452 - 17912530
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
17912452 |
taaaatatgattttagtccctgcaaatatgtctcgttttggttttagtctctggtaaaaaaaaaattgtttttggtccc |
17912530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 157 - 237
Target Start/End: Original strand, 37271739 - 37271820
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaa-ttgtttttggtcc |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
37271739 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaatttgtttttggtcc |
37271820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 41693674 - 41693755
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
41693674 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctgtaaaaaaaaaaattgtttttggtccc |
41693755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 152 - 238
Target Start/End: Original strand, 43788853 - 43788940
Alignment:
| Q |
152 |
aaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaa-ttgtttttggtccc |
238 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||| |||||| |||||||||||||| |
|
|
| T |
43788853 |
aaataggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttggtaaaaaaaaaatttgtttttggtccc |
43788940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 157 - 223
Target Start/End: Original strand, 19183782 - 19183848
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaa |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
19183782 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaaaaaaaa |
19183848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 26814229 - 26814147
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaa-ttgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |||||||| ||||| |
|
|
| T |
26814229 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaatttgttttttgtccc |
26814147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 44073807 - 44073725
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt-aaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
44073807 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctggtaaaaaaaaaaattgtttttggtccc |
44073725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 157 - 237
Target Start/End: Original strand, 7814246 - 7814325
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtcc |
237 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||| ||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
7814246 |
ggctaaaatattgttttagtccctgtaaatatgcctcgttttggttttagtccctggtaaa-aaaaaattgtttttggtcc |
7814325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 157 - 237
Target Start/End: Original strand, 10664984 - 10665063
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtcc |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| | ||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
10664984 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgatattagtccct-gtaaaaaaaaaattgtttttggtcc |
10665063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 154 - 238
Target Start/End: Complemental strand, 33733244 - 33733161
Alignment:
| Q |
154 |
attggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |||| |||||||||||||||||||| |
|
|
| T |
33733244 |
attggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccct-ataaaaaaaaaattgtttttggtccc |
33733161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 11713482 - 11713540
Alignment:
| Q |
154 |
attggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11713482 |
attggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
11713540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 160 - 238
Target Start/End: Complemental strand, 17912808 - 17912730
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||| |||||||||||| |||||||||||||||||| |||||||| ||||| |||||||||||||| |
|
|
| T |
17912808 |
taaaatatggttttagttcctgcaaatatgcctcgttttggttttagtctctggtaaaaaaaaatttgtttttggtccc |
17912730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 36622250 - 36622328
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||| ||||||||||||| |
|
|
| T |
36622250 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccct-gtaa--aaaaaaatgtttttggtccc |
36622328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 43789192 - 43789110
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaa-ttgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
43789192 |
ggctaaaatatggttttagttcctgcaaatatgcttcgttttggttttagtccctggtaaaaaaaaaatttgtttttggtccc |
43789110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 16900206 - 16900126
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||| ||| ||||| ||||| |
|
|
| T |
16900206 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaa-aaaatattttttttagtccc |
16900126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 16993597 - 16993517
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||| ||| ||||| ||||| |
|
|
| T |
16993597 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaa-aaaatattttttttagtccc |
16993517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 22881613 - 22881692
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||| ||| ||||| |||||||||||||||||||| |
|
|
| T |
22881613 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt-ccttgtaaa-aaaaaattgtttttggtccc |
22881692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 24483891 - 24483812
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| |||||||| ||||||||||| |
|
|
| T |
24483891 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct-gtaaa-aaaaaattatttttggtccc |
24483812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 25954115 - 25954196
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |||||||||||||||||| || ||| |||||||||||||||||||| |
|
|
| T |
25954115 |
ggctaaaatatgtttttagtccctgcaaatatgtttcgttttggttttagtccttgtaaaaaaaaaaattgtttttggtccc |
25954196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 27310876 - 27310955
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||| |||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
27310876 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgg-tttagtccct-gtaaaaaaaaaattgtttttggtccc |
27310955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 38731829 - 38731908
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| ||||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
38731829 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct-gtaaa-aaaaaattgtttttggtccc |
38731908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 156 - 235
Target Start/End: Original strand, 38979888 - 38979969
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatat-gtctcgttttggttttagtccctggt-aaataaaaaattgtttttggt |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
38979888 |
tggctaaaatatggttttagtccctgcaaatatattctcgttttggttttagtccctggtaaaaaaaaaaattgtttttggt |
38979969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 148 - 238
Target Start/End: Complemental strand, 40302348 - 40302257
Alignment:
| Q |
148 |
ttttaaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaa--ttgtttttggtccc |
238 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| |||||| |||||||||||||| |
|
|
| T |
40302348 |
ttttatataggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtccct-gtaaacaaaaaattttgtttttggtccc |
40302257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 43597499 - 43597420
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
43597499 |
ggctaaaatatgattttagtccctgctaatatgtctcgttttggttttagtccct-gtaaa-aaaaaattgtttttggtccc |
43597420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 157 - 233
Target Start/End: Complemental strand, 2265397 - 2265322
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttg |
233 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||||||||||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
2265397 |
ggctaaaatatgattttagtccttgcaaatatgtctcgttttggttttagtccct-gtaaaaaaaaaattgtttttg |
2265322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 146 - 218
Target Start/End: Original strand, 5790547 - 5790619
Alignment:
| Q |
146 |
tattttaaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaat |
218 |
Q |
| |
|
|||| |||| ||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
5790547 |
tattataaaatggctaaaatatggtcttagtccctgcaaatatgcctcgttttggttttagtccctggtaaat |
5790619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 157 - 237
Target Start/End: Complemental strand, 9195206 - 9195127
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtcc |
237 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| ||||||||||||||||||||| ||||| ||||| ||||||||||||| |
|
|
| T |
9195206 |
ggctaaaatatggttttagaccctgcaaatatgcctcgttttggttttagtccct-gtaaaaaaaaatttgtttttggtcc |
9195127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 152 - 212
Target Start/End: Complemental strand, 11788421 - 11788361
Alignment:
| Q |
152 |
aaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11788421 |
aaataggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
11788361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 147 - 211
Target Start/End: Original strand, 42695858 - 42695922
Alignment:
| Q |
147 |
attttaaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccct |
211 |
Q |
| |
|
|||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42695858 |
atttaaaattggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
42695922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 157 - 237
Target Start/End: Complemental strand, 26239160 - 26239078
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaa--ttgtttttggtcc |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||| |||||| ||||||||||||| |
|
|
| T |
26239160 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgcaaaaaaaaaaaatttgtttttggtcc |
26239078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 155 - 237
Target Start/End: Complemental strand, 41694005 - 41693922
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaa-taaaaaattgtttttggtcc |
237 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |||||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
41694005 |
ttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaagaaaaaaattgtttttggtcc |
41693922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 155 - 237
Target Start/End: Original strand, 1497608 - 1497690
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtcc |
237 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||||| |||||||||||| ||| ||||| ||||||||||||| |
|
|
| T |
1497608 |
ttggctaaaatatggttttagtccttgcaaatatgcctcgttttgattttagtccctgtaaaaaaaaaatttgtttttggtcc |
1497690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 151 - 209
Target Start/End: Complemental strand, 10671947 - 10671889
Alignment:
| Q |
151 |
taaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10671947 |
taaataggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
10671889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 160 - 238
Target Start/End: Original strand, 26238816 - 26238892
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||| |||||||||| ||||||||| |
|
|
| T |
26238816 |
taaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccct-gtaaa-aaaaaattgtgtttggtccc |
26238892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 33732862 - 33732940
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||| ||||||||||||||| |||| |
|
|
| T |
33732862 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct-gtaa--aaaaaattgtttttgatccc |
33732940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 146 - 212
Target Start/End: Original strand, 41451826 - 41451892
Alignment:
| Q |
146 |
tattttaaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||| ||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41451826 |
tatttttaataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
41451892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 159 - 237
Target Start/End: Original strand, 44985623 - 44985701
Alignment:
| Q |
159 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtcc |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||| || || ||||||||||||| |
|
|
| T |
44985623 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaagaatttgtttttggtcc |
44985701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 3671003 - 3671083
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||||||||| ||||||||||| || || |||||||||||||||||||| |
|
|
| T |
3671003 |
ggctaaaatatggttttagtccatgcaaatatgcctcgttttgattttagtccct-gtgaaaaaaaaattgtttttggtccc |
3671083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 27311069 - 27310990
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||||||||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
27311069 |
ggctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtccct-ataaa-aaaaaattgtttttggtccc |
27310990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 148 - 237
Target Start/End: Original strand, 32691304 - 32691392
Alignment:
| Q |
148 |
ttttaaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtcc |
237 |
Q |
| |
|
|||| ||| |||||||||||||||||||| ||||||||||| ||||||||||||||| ||||| ||||| ||||||||||||||||||| |
|
|
| T |
32691304 |
ttttcaataggctaaaatatggttttagtttctgcaaatatgcctcgttttggttttaatccct-gtaaaaaaaaaattgtttttggtcc |
32691392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 159 - 236
Target Start/End: Original strand, 41791020 - 41791097
Alignment:
| Q |
159 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtc |
236 |
Q |
| |
|
||||||||||||||||||||||| ||||||| ||| |||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
41791020 |
ctaaaatatggttttagtccctgtaaatatgcctcattttggttttagtccctgtaaaaaaaaaaattgtttttggtc |
41791097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 156 - 212
Target Start/End: Original strand, 9195053 - 9195109
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
9195053 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
9195109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 156 - 212
Target Start/End: Complemental strand, 10375070 - 10375014
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
10375070 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaatccctg |
10375014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 158 - 238
Target Start/End: Original strand, 24483401 - 24483479
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
24483401 |
gctaaaatatggctttagtccttgcaaatatgcctcgttttggttttagtccct-gtaaa-aaaaaattgtttttggtccc |
24483479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 157 - 229
Target Start/End: Original strand, 25705085 - 25705155
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtt |
229 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
25705085 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct-gtaaa-aaaaaattgtt |
25705155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 157 - 229
Target Start/End: Original strand, 31644841 - 31644912
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtt |
229 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||| || ||||| ||||||||||| |
|
|
| T |
31644841 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtctct-gtaaaaaaaaaattgtt |
31644912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 157 - 236
Target Start/End: Complemental strand, 44985984 - 44985904
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg-gtaaataaaaaattgtttttggtc |
236 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
44985984 |
ggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctgtaaaaataaaattttgtttttggtc |
44985904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 4424185 - 4424130
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4424185 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
4424130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 147 - 238
Target Start/End: Complemental strand, 8046658 - 8046570
Alignment:
| Q |
147 |
attttaaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||| || ||||||||||||||||||||||||| |||||||| ||||||||||||||||||||| ||||| |||||||| ||||||||||| |
|
|
| T |
8046658 |
attttgaaatggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccct-gtaaa-aaaaaatt-tttttggtccc |
8046570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 13215060 - 13215115
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13215060 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
13215115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 20131317 - 20131372
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20131317 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
20131372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 33576117 - 33576062
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33576117 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
33576062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 157 - 232
Target Start/End: Original strand, 40786460 - 40786535
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgttttt |
232 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||||||||||||||||||||| ||| |||| ||||||||| |
|
|
| T |
40786460 |
ggctaaaatatggttttattcactgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaatattgttttt |
40786535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 44559062 - 44559117
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44559062 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
44559117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 3671195 - 3671137
Alignment:
| Q |
154 |
attggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3671195 |
attggctcaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
3671137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 147 - 209
Target Start/End: Complemental strand, 4042900 - 4042838
Alignment:
| Q |
147 |
attttaaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
|||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
4042900 |
attttagattggctaaaatatggtttaggtccctgcaaatatgtctcgttttggttttagtcc |
4042838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 7814737 - 7814658
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||| |||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
7814737 |
ggctaaaatatgattttagtccctgcaaatatgcctcattttggttttagtccctgtcaa--aaaaaattgtttttggtccc |
7814658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 158 - 212
Target Start/End: Complemental strand, 20939324 - 20939270
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20939324 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
20939270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 152 - 238
Target Start/End: Original strand, 26707868 - 26707952
Alignment:
| Q |
152 |
aaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||| |||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
26707868 |
aaataggctaaaatatggttttaatccctgcaaatatacttcgttttggttttagtccct-gtaaa-aaaaaattgtttttggtccc |
26707952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 147 - 229
Target Start/End: Complemental strand, 30215881 - 30215800
Alignment:
| Q |
147 |
attttaaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtt |
229 |
Q |
| |
|
|||||| || ||||||||||||||||| |||||||||||||| || ||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
30215881 |
attttatataggctaaaatatggttttggtccctgcaaatatatcgcgttttggttttagtccct-gtaaaaaaaaaattgtt |
30215800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 43597154 - 43597232
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||||||||||||||||| |||| |||||| ||||||||||||| |
|
|
| T |
43597154 |
ggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccct-gtaa--aaaaaaatgtttttggtccc |
43597232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 156 - 229
Target Start/End: Complemental strand, 146691 - 146620
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtt |
229 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
146691 |
tggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccct-gtaaa-aaaaaattgtt |
146620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 5334749 - 5334806
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
5334749 |
ttggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
5334806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 20658061 - 20658140
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| || |||||||||||||||||| ||||| |||||||||||||| ||||| |
|
|
| T |
20658061 |
ggctaaaacatggttttagtccctgcaaatatgccttgttttggttttagtccct-gtaaa-aaaaaattgtttttagtccc |
20658140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 23989838 - 23989917
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |||||||||||||||||| || |||| |||||||||||||||||||| |
|
|
| T |
23989838 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtcact-ataaa-aaaaaattgtttttggtccc |
23989917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 29865511 - 29865431
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |||||||||||||||||||| ||||| |||| |||||||||||||| |
|
|
| T |
29865511 |
ggctaaaatatggttttagtccttgcaaatatgcttcgttttggttttagtccct-gtaaaataaaatttgtttttggtccc |
29865431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 156 - 229
Target Start/End: Complemental strand, 36806897 - 36806826
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtt |
229 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
36806897 |
tggccaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct-gtaaa-aaaaaattgtt |
36806826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 157 - 237
Target Start/End: Original strand, 43592046 - 43592127
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaa-aaattgtttttggtcc |
237 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |||||||||||||||||||||| ||| ||| || ||||||||||||| |
|
|
| T |
43592046 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgtaaaaaaaataatttgtttttggtcc |
43592127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 43710708 - 43710629
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||| |||||| || |||||||||| ||||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
43710708 |
ggctaaaatatgattttagcccttgcaaatatgcctcgttttggttttagtccct-gtaaa-aaaaaattgtttttggtccc |
43710629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 156 - 212
Target Start/End: Complemental strand, 5335041 - 5334985
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
5335041 |
tggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
5334985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 11713845 - 11713763
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaa--ttgtttttggtccc |
238 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| ||||||||||||||||||||| ||||| ||| || |||||||||||||| |
|
|
| T |
11713845 |
ggctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccct-gtaaaaaaataattttgtttttggtccc |
11713763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #80
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 157 - 229
Target Start/End: Complemental strand, 16523325 - 16523255
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtt |
229 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
16523325 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccct-gtaaa-aaaaaattgtt |
16523255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #81
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 156 - 212
Target Start/End: Complemental strand, 20131682 - 20131626
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
20131682 |
tggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
20131626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #82
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 155 - 238
Target Start/End: Original strand, 31325918 - 31326002
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaatt-gtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| ||||||| ||||||||||||| ||||||||| || |||||||||||| |
|
|
| T |
31325918 |
ttggctaaaatatggttctagtccctgcaaatatgcatcgttttagttttagtccctgtaaaataaaaatttcgtttttggtccc |
31326002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #83
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 160 - 212
Target Start/End: Original strand, 42358702 - 42358754
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
42358702 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
42358754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #84
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 2481557 - 2481502
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2481557 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
2481502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #85
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 3837933 - 3837988
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
3837933 |
ggctaaaatatagttttagtccctgcaaatatgtctcgttttcgttttagtccctg |
3837988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #86
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 158 - 238
Target Start/End: Complemental strand, 3838263 - 3838182
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaa--ttgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||| | |||| |||||||||||||| |
|
|
| T |
3838263 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccct-gtaaaaagaaaattttgtttttggtccc |
3838182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #87
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 4423895 - 4423950
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
4423895 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
4423950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #88
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 4794130 - 4794185
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4794130 |
ggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
4794185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #89
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 8046329 - 8046384
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
8046329 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctg |
8046384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #90
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 10671630 - 10671685
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10671630 |
ggctaaaatatggttttggtccctgcaaatatatctcgttttggttttagtccctg |
10671685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #91
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 14003742 - 14003687
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
14003742 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
14003687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #92
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 15842823 - 15842768
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
15842823 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
15842768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #93
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 16522991 - 16523046
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
16522991 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
16523046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #94
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 16673411 - 16673466
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
16673411 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
16673466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #95
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 17302143 - 17302088
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
17302143 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtccctg |
17302088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #96
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 175 - 238
Target Start/End: Complemental strand, 22881950 - 22881889
Alignment:
| Q |
175 |
gtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
22881950 |
gtccctgcaaatatgtctcgttttggttttagtccct-gtaaa-aaaaaattgtttttggtccc |
22881889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #97
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 24358616 - 24358671
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
24358616 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
24358671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #98
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 25705449 - 25705394
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
25705449 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
25705394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #99
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 160 - 238
Target Start/End: Complemental strand, 25954423 - 25954344
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaa-attgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| |||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
25954423 |
taaaatatggttttagtccttgcaaatatgcctcgttttgattttagtccctgtaaaataaaaattttgtttttggtccc |
25954344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #100
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 29859872 - 29859817
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
29859872 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
29859817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #101
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 33575752 - 33575807
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33575752 |
ggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
33575807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #102
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 153 - 212
Target Start/End: Complemental strand, 34964163 - 34964104
Alignment:
| Q |
153 |
aattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
34964163 |
aattggctaaaatatggttttggtccctgcaaatatgtctcgttttagttttagcccctg |
34964104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #103
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 159 - 238
Target Start/End: Complemental strand, 36622582 - 36622504
Alignment:
| Q |
159 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| || ||||| ||||| |||||||||||||| |
|
|
| T |
36622582 |
ctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtttct-gtaaaaaaaaatttgtttttggtccc |
36622504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #104
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 237
Target Start/End: Complemental strand, 44994061 - 44993979
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg--gtaaataaaaaattgtttttggtcc |
237 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||| ||||||||| ||| ||| ||||||||||||||||||| |
|
|
| T |
44994061 |
ggctaaaatatggttttaatccctgcaaatatgtctcgttttagttttagtctctgtaaaaaaaaaaaaattgtttttggtcc |
44993979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #105
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 158 - 212
Target Start/End: Original strand, 10374775 - 10374829
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
10374775 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg |
10374829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #106
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 160 - 238
Target Start/End: Original strand, 16968555 - 16968631
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||| |||||||| || |||||||||||||||||| ||||| ||||||||||||||| |||| |
|
|
| T |
16968555 |
taaaatatggttttagtccctacaaatatgccttgttttggttttagtccct-gtaaa-aaaaaattgtttttgctccc |
16968631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #107
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 160 - 238
Target Start/End: Complemental strand, 23990193 - 23990117
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||| | ||||| ||||||||||||||| |||| |
|
|
| T |
23990193 |
taaaatatggttttagtccttgcaaatatgtctcgttttggttttagtcac-cgtaaa-aaaaaattgtttttgatccc |
23990117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #108
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 153 - 211
Target Start/End: Original strand, 27109069 - 27109127
Alignment:
| Q |
153 |
aattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccct |
211 |
Q |
| |
|
||||||||||||||||||||| |||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
27109069 |
aattggctaaaatatggttttggtccctacaaatatgcctcgttttggttttagtccct |
27109127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #109
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 158 - 212
Target Start/End: Original strand, 29865222 - 29865276
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||| |||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
29865222 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
29865276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #110
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 31226077 - 31225995
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg-gtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||| |||||| ||| |||||||||||||| ||||| |
|
|
| T |
31226077 |
ggctaaaatatggttttactccctgcaaatatgcctcgttttggttttactccctgtaaaaaaaaaaaattgttttttgtccc |
31225995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #111
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 34317795 - 34317853
Alignment:
| Q |
154 |
attggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
34317795 |
attggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
34317853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #112
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 163 - 209
Target Start/End: Original strand, 35155298 - 35155344
Alignment:
| Q |
163 |
aatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35155298 |
aatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
35155344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #113
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 159 - 212
Target Start/End: Original strand, 146328 - 146381
Alignment:
| Q |
159 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
146328 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
146381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #114
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 14393128 - 14393049
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||| ||| ||| |||||||||||||||||||||||||||||||| | ||||| |||||||||||||| ||||| |
|
|
| T |
14393128 |
ggctaaaatatgattt-agttcctgcaaatatgtctcgttttggttttagtccat-gtaaaaaaaaaattgttttttgtccc |
14393049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #115
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 29859485 - 29859542
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
29859485 |
ttggttaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
29859542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #116
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 159 - 208
Target Start/End: Complemental strand, 44559407 - 44559358
Alignment:
| Q |
159 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
44559407 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
44559358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #117
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 156 - 212
Target Start/End: Original strand, 12835324 - 12835380
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
12835324 |
tggctaaaatatgattttagtccctgcaaatatgcctcattttggttttagtccctg |
12835380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #118
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 160 - 212
Target Start/End: Original strand, 15842464 - 15842516
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
15842464 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
15842516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #119
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 40301975 - 40302057
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaa--ttgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||| |||||||||||| ||||| | |||| |||||||||||||| |
|
|
| T |
40301975 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttagttttagtccct-gtaaaaagaaaattttgtttttggtccc |
40302057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #120
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 157 - 237
Target Start/End: Complemental strand, 43592380 - 43592300
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtcc |
237 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||| ||||| ||||||||| || ||| ||||| ||||||||||||| |
|
|
| T |
43592380 |
ggctaaaatatgattttagtccctgctaatatgtctcattttgattttagtccttgtaaaaaaaaaatttgtttttggtcc |
43592300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #121
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 45442696 - 45442644
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
45442696 |
ggctaaaatatgattttagtccttgcaaatatgtctcgttttggttttagtcc |
45442644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #122
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 1138359 - 1138304
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
1138359 |
ggctaaaatatggttttgatccctgcaaatatgtctcgttttagttttagtccctg |
1138304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #123
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 2481193 - 2481248
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| || | ||||||||||||||||||||||||||||||||| |
|
|
| T |
2481193 |
ggctaaaatatggttttggtacttgcaaatatgtctcgttttggttttagtccctg |
2481248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #124
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 14003409 - 14003464
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
14003409 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
14003464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #125
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 16673771 - 16673716
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
16673771 |
ggctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtccctg |
16673716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #126
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 18113089 - 18113144
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
18113089 |
ggctaaaatatggttttggtccctgcaaatatgcctagttttggttttagtccctg |
18113144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #127
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 20658409 - 20658324
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttg--gttttagtccctggtaaataaaaaa--ttgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||| |||||||||||| ||| |||||| |||||||||||||| |
|
|
| T |
20658409 |
ggctaaaatatggttttaatccctgcaaatatgtctcgttttgattttttagtccctgtaaaaaaaaaaaatttgtttttggtccc |
20658324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #128
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 24358945 - 24358890
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
24358945 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctg |
24358890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #129
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 30215422 - 30215477
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
30215422 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
30215477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #130
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 36815835 - 36815780
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
36815835 |
ggctaaaatatggttttggtccatgcaaatatgtctcgttttggttttagttcctg |
36815780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #131
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 208
Target Start/End: Original strand, 37228733 - 37228784
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| ||||||||||||||||| |
|
|
| T |
37228733 |
ggctaaaatatggttttggtccctgcaaatatgtatcgttttggttttagtc |
37228784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #132
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 155 - 238
Target Start/End: Original strand, 43710379 - 43710460
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||| |||||||| ||||||||||| |||||||||||||||||||||||||||||| |||| |||||| ||||||||||||| |
|
|
| T |
43710379 |
ttggttaaaatataattttagtcccttcaaatatgtctcgttttggttttagtccct-ataaa-aaaaaaatgtttttggtccc |
43710460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #133
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 155 - 209
Target Start/End: Original strand, 23732037 - 23732091
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
23732037 |
ttggctaaaatatgattttgatccctgcaaatatgtctcgttttggttttagtcc |
23732091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #134
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 31326252 - 31326170
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaa-aattgtttttggtccc |
238 |
Q |
| |
|
||||||||||| |||||||||| |||||||||| |||||||| ||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
31326252 |
ggctaaaatatagttttagtccttgcaaatatgcctcgttttagttttagtccctgtaaaataaaatttttgtttttggtccc |
31326170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #135
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 45442316 - 45442394
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||| ||||| | | | |||| |||||||||||||||||||| |
|
|
| T |
45442316 |
ggctaaaatatggttttagtctctgcaaatatgtctcgttttgattttaattcgt-gtaa--aaaaaattgtttttggtccc |
45442394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #136
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 159 - 212
Target Start/End: Original strand, 1137983 - 1138036
Alignment:
| Q |
159 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
1137983 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctg |
1138036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #137
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 159 - 212
Target Start/End: Complemental strand, 1497943 - 1497890
Alignment:
| Q |
159 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||| ||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
1497943 |
ctaaaatatggttttattccttgcaaatatgcctcgttttggttttagtccctg |
1497890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #138
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 158 - 211
Target Start/End: Original strand, 4842865 - 4842918
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccct |
211 |
Q |
| |
|
|||||||||||||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
4842865 |
gctaaaatatggttttggatcctgcaaatatgtctcgttttggttttagtccct |
4842918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #139
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 151 - 212
Target Start/End: Complemental strand, 18113460 - 18113399
Alignment:
| Q |
151 |
taaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||||||||| |||||| |||||||| |||||||||||||| |||||| |
|
|
| T |
18113460 |
taaattggctaaaatatggttttggtccctacaaatatgcttcgttttggttttaatccctg |
18113399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #140
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 152 - 209
Target Start/End: Complemental strand, 34318088 - 34318031
Alignment:
| Q |
152 |
aaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
|||||||||||||||||||||| |||||| |||||||| ||||||||| ||||||||| |
|
|
| T |
34318088 |
aaattggctaaaatatggttttggtccctacaaatatgcctcgttttgattttagtcc |
34318031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #141
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 40124964 - 40125021
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| ||||||||||||| |||| |
|
|
| T |
40124964 |
ttggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagttcctg |
40125021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #142
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 155 - 208
Target Start/End: Complemental strand, 41791314 - 41791261
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||| |||| |
|
|
| T |
41791314 |
ttggctaaaatatggttttagtccctgcaaatatgcttcgttttggtttaagtc |
41791261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #143
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 160 - 208
Target Start/End: Complemental strand, 3832634 - 3832586
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
|||||||||||||| |||||||||||||||| ||||||||||||||||| |
|
|
| T |
3832634 |
taaaatatggttttggtccctgcaaatatgtttcgttttggttttagtc |
3832586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #144
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 4042610 - 4042662
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
4042610 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
4042662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #145
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 162 - 238
Target Start/End: Complemental strand, 4794468 - 4794392
Alignment:
| Q |
162 |
aaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||||||||||||||| ||| ||| ||| |||||||||||||| |
|
|
| T |
4794468 |
aaatatggttttggtccctacaaatatgtctcgttttggttttagtctctgtaaaaaaaattgttgtttttggtccc |
4794392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #146
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 157 - 229
Target Start/End: Original strand, 32476095 - 32476165
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtt |
229 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||| ||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
32476095 |
ggctaaaatatggttttgatccctgcaaatatgcctcattttggttttagtccct-gtaaa-aaaaaattgtt |
32476165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #147
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 157 - 204
Target Start/End: Complemental strand, 13215365 - 13215318
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttt |
204 |
Q |
| |
|
||||||||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
13215365 |
ggctaaaatatgggtttggtccctgcaaatatgtctcgttttggtttt |
13215318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #148
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 156 - 227
Target Start/End: Complemental strand, 19604979 - 19604908
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattg |
227 |
Q |
| |
|
||||||||||||| |||| ||||||| ||||||| ||| ||| |||||| |||||||||||| ||||||||| |
|
|
| T |
19604979 |
tggctaaaatatgtttttggtccctgtaaatatggctcatttgggttttggtccctggtaaaaaaaaaattg |
19604908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #149
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 157 - 208
Target Start/End: Original strand, 26709696 - 26709747
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
26709696 |
ggctaaaatatgattttagttcctgcaaatatgtctcgttttggtcttagtc |
26709747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #150
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 31225715 - 31225770
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| ||||||||| ||||||| |||| |
|
|
| T |
31225715 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttgattttagttcctg |
31225770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #151
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 35155619 - 35155564
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||||| |||||| |||||||||||| |
|
|
| T |
35155619 |
ggctaaaatatggttttggtccctgaaaatatgtcttgttttgattttagtccctg |
35155564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #152
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 37911120 - 37911065
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
37911120 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttaatccctg |
37911065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #153
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 158 - 209
Target Start/End: Complemental strand, 42696202 - 42696151
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
42696202 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
42696151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #154
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 43672318 - 43672263
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
43672318 |
ggctaaaatatgattttggtccctgcaaatatgttttgttttggttttagtccctg |
43672263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #155
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 160 - 226
Target Start/End: Original strand, 19831511 - 19831576
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaatt |
226 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||||||||||||| ||| ||||| |||||||| |
|
|
| T |
19831511 |
taaaatatggttttagtctttgcaaatatgtttcgttttggttttagttcct-gtaaaaaaaaaatt |
19831576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #156
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 167 - 213
Target Start/End: Complemental strand, 33576076 - 33576030
Alignment:
| Q |
167 |
tggttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
33576076 |
tggttttagtccctgcaaatatgtctcattttggttttggtccctgg |
33576030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #157
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 160 - 238
Target Start/End: Complemental strand, 38732130 - 38732054
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||| || |||||||||| ||||||||| ||||||||||||||| ||||| ||||| |||||||| ||||||||||| |
|
|
| T |
38732130 |
taaaatttgattttagtcccagcaaatatggctcgttttggttttaatccct-gtaaa-aaaaaattatttttggtccc |
38732054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #158
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 1295549 - 1295492
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
1295549 |
ttggttaaaatatggttttgattcctgcaaatatgtttcgttttggttttagtccctg |
1295492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #159
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 157 - 198
Target Start/End: Complemental strand, 32691635 - 32691594
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgtttt |
198 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
32691635 |
ggctaaaacatggttttagtccctgcaaatatgtctcgtttt |
32691594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #160
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 159 - 212
Target Start/End: Original strand, 44993806 - 44993858
Alignment:
| Q |
159 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||| |||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
44993806 |
ctaaaatatggttgtagtcc-tgcaaatatgtctcgttttggttttactccctg |
44993858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #161
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 3172020 - 3172072
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
3172020 |
ggctaaaatatgattttggtccctgcaaatatgcctcattttggttttagtcc |
3172072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #162
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 3172532 - 3172480
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
|||||||||||| |||| |||| |||||||||| ||||||||||||||||||| |
|
|
| T |
3172532 |
ggctaaaatatgattttggtccttgcaaatatgcctcgttttggttttagtcc |
3172480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #163
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 10665294 - 10665212
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaa--ttgtttttggtccc |
238 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||| |||||||||||||||| ||| ||||| | |||| |||||||||||||| |
|
|
| T |
10665294 |
ggctaaaatatagttttagtctctgcaaatatgcatcgttttggttttagttcct-gtaaaaagaaaattttgtttttggtccc |
10665212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #164
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 152 - 212
Target Start/End: Original strand, 13850517 - 13850577
Alignment:
| Q |
152 |
aaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||| ||||||||||| ||||| || |||||||||||||||| ||||||||||||||||| |
|
|
| T |
13850517 |
aaataggctaaaatatagttttgatctctgcaaatatgtctcgatttggttttagtccctg |
13850577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #165
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 157 - 229
Target Start/End: Complemental strand, 23732328 - 23732259
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtt |
229 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||| |||||||||| |||||||||| ||||| ||||||||||| |
|
|
| T |
23732328 |
ggctaaaatatggttttggtctctgcaaatatgcctcgttttgg-tttagtccct-gtaaa-aaaaaattgtt |
23732259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #166
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 159 - 207
Target Start/End: Complemental strand, 29182440 - 29182392
Alignment:
| Q |
159 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
207 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
29182440 |
ctaaaatatgattttgatccctgcaaatatgtctcgttttggttttagt |
29182392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #167
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 160 - 207
Target Start/End: Original strand, 5006610 - 5006657
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
207 |
Q |
| |
|
|||||||||||||| ||| |||||||||| |||||||||||||||||| |
|
|
| T |
5006610 |
taaaatatggttttggtctctgcaaatatatctcgttttggttttagt |
5006657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #168
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 157 - 208
Target Start/End: Complemental strand, 31909478 - 31909428
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
31909478 |
ggctaaaatatggttttggtccctgcaaatatgcctc-ttttggttttagtc |
31909428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #169
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 36815488 - 36815543
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| | ||| |||||||||||||||||||||||||||||| |
|
|
| T |
36815488 |
ggctaaaatatggttttgccctctgtaaatatgtctcgttttggttttagtccctg |
36815543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #170
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 160 - 207
Target Start/End: Complemental strand, 37229039 - 37228992
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
207 |
Q |
| |
|
|||||||||||||| |||||||||||||| | |||||||||||||||| |
|
|
| T |
37229039 |
taaaatatggttttggtccctgcaaatatatttcgttttggttttagt |
37228992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #171
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 40125289 - 40125234
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||| |||| ||||||||||||| |
|
|
| T |
40125289 |
ggctaaaatatgattttggtccctgcaaatatgcctcatttttgttttagtccctg |
40125234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #172
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 43671934 - 43671989
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||| |||||||||||||||| |||| |
|
|
| T |
43671934 |
ggctaaaatatggtttttgtccctgtaaatatgcttcgttttggttttagttcctg |
43671989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #173
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 157 - 223
Target Start/End: Complemental strand, 2412487 - 2412421
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaa |
223 |
Q |
| |
|
|||||||||||| |||| |||||||||||||| | |||| ||||||||||||||||||| ||||| |
|
|
| T |
2412487 |
ggctaaaatatgtttttggtccctgcaaatatagcgagtttgggttttagtccctggtaaaaaaaaa |
2412421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #174
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 152 - 238
Target Start/End: Complemental strand, 7121313 - 7121228
Alignment:
| Q |
152 |
aaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||| |||| |||||||| || |||| |||||||||| || ||| ||| |||||||||||||| |
|
|
| T |
7121313 |
aaattggctaaaatatggttttagt-cctgtaaatatgtttcattttagttttagtccttgtaaaaaaaattgttgtttttggtccc |
7121228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #175
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 177 - 238
Target Start/End: Complemental strand, 26708184 - 26708122
Alignment:
| Q |
177 |
ccctgcaaatatgtctcgttttggttttagtccctg-gtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
26708184 |
ccctgcaaatacgcctcgttttggttttagtccctgtaaaaaaaaaaaattgtttttggtccc |
26708122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #176
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 157 - 203
Target Start/End: Original strand, 29831814 - 29831860
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
203 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
29831814 |
ggctaaaatatagttttgatccctgcaaatatgtctcgttttggttt |
29831860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #177
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 162 - 207
Target Start/End: Original strand, 11943543 - 11943588
Alignment:
| Q |
162 |
aaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
207 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
11943543 |
aaatatggttttagtcaatgcgaatatgtctcgttttggttttagt |
11943588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #178
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 159 - 212
Target Start/End: Original strand, 25299747 - 25299800
Alignment:
| Q |
159 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||| |||| ||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
25299747 |
ctaaaatatgattttggtccctgcaaatatgactcgttttaattttagtccctg |
25299800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #179
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 37910756 - 37910837
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||| ||| |||||||||| ||| |||| ||||||||||||| ||| ||| |||||||||||||| |
|
|
| T |
37910756 |
ggctaaaatatggttttgatccttgcaaatatgcctcattttagttttagtccctgtaaaaaaaattgttgtttttggtccc |
37910837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #180
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 170 - 210
Target Start/End: Original strand, 1138055 - 1138095
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccc |
210 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
1138055 |
ttttggtccctgcaaatatgtctcgttttggttttggtccc |
1138095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #181
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 160 - 208
Target Start/End: Complemental strand, 13850881 - 13850833
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
|||||||||||||| || |||||||||||| ||||||||||||||||| |
|
|
| T |
13850881 |
taaaatatggttttggttcctgcaaatatgcttcgttttggttttagtc |
13850833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #182
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 159 - 207
Target Start/End: Complemental strand, 25300038 - 25299991
Alignment:
| Q |
159 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
207 |
Q |
| |
|
||||||||||||||| |||||||||||||||| || ||||||||||||| |
|
|
| T |
25300038 |
ctaaaatatggttttggtccctgcaaatatgtttc-ttttggttttagt |
25299991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #183
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 146399 - 146442
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
146399 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgg |
146442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #184
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 160 - 203
Target Start/End: Complemental strand, 1696452 - 1696409
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttt |
203 |
Q |
| |
|
||||||||| |||| |||||| |||||||||||||||||||||| |
|
|
| T |
1696452 |
taaaatatgattttcgtcccttcaaatatgtctcgttttggttt |
1696409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #185
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 2481266 - 2481309
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
2481266 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgg |
2481309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #186
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 3832344 - 3832387
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||| |||| |
|
|
| T |
3832344 |
ttttagtccctgcaaatatgtctcattttggttttggtctctgg |
3832387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #187
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Complemental strand, 5334967 - 5334924
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
5334967 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgg |
5334924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #188
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 15842534 - 15842577
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
15842534 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgg |
15842577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #189
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 16673484 - 16673527
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
16673484 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgg |
16673527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #190
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 16900135 - 16900100
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggtttta |
205 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |
|
|
| T |
16900135 |
ttttagtccctgcaaatatgcctcgttttggtttta |
16900100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #191
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 205
Target Start/End: Complemental strand, 16993526 - 16993491
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggtttta |
205 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |
|
|
| T |
16993526 |
ttttagtccctgcaaatatgcctcgttttggtttta |
16993491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #192
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 20131390 - 20131433
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
20131390 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgg |
20131433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #193
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Complemental strand, 24358872 - 24358829
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
24358872 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgg |
24358829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #194
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Complemental strand, 25705376 - 25705333
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
25705376 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgg |
25705333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #195
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 157 - 208
Target Start/End: Original strand, 29182168 - 29182219
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
|||||||||||| |||| |||| ||||||||||| || |||||||||||||| |
|
|
| T |
29182168 |
ggctaaaatatgattttggtccttgcaaatatgtttcattttggttttagtc |
29182219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #196
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 29859560 - 29859603
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
29859560 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgg |
29859603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #197
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 30215495 - 30215538
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
30215495 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgg |
30215538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #198
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 40125039 - 40125082
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
40125039 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgg |
40125082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #199
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 43672005 - 43672048
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
43672005 |
ttttggtccctgcaaatatgtttcgttttggttttcgtccctgg |
43672048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #200
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 170 - 212
Target Start/End: Original strand, 1696195 - 1696236
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
1696195 |
ttttagtccctgcaaata-gtctcgttttggttttggtccctg |
1696236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #201
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 160 - 238
Target Start/End: Original strand, 14392791 - 14392867
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||| || ||||||| |||||||| |||||| | ||| ||||| ||||| |||||||||||||| |
|
|
| T |
14392791 |
taaaatatggttttagtcattgtaaatatgcctcgttttagttttaat-ccttgtaaa-aaaaatttgtttttggtccc |
14392867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #202
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 157 - 211
Target Start/End: Original strand, 17301984 - 17302036
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccct |
211 |
Q |
| |
|
||||||||||||||||| |||| || |||||| |||||||||||||||||||||| |
|
|
| T |
17301984 |
ggctaaaatatggttttggtcc-tgaaaatat-tctcgttttggttttagtccct |
17302036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #203
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 170 - 212
Target Start/End: Complemental strand, 23732256 - 23732214
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
23732256 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
23732214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #204
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 170 - 212
Target Start/End: Original strand, 37228795 - 37228837
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
37228795 |
ttttggtccctgcaaatgtgtctcgttttggttttggtccctg |
37228837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #205
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 157 - 226
Target Start/End: Original strand, 1777469 - 1777538
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaatt |
226 |
Q |
| |
|
|||||||||||| |||| |||||||||||||| | |||| ||||| |||||||||||| |||||||| |
|
|
| T |
1777469 |
ggctaaaatatgtttttggtccctgcaaatatagcgagtttgagttttggtccctggtaaaaaaaaaatt |
1777538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #206
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 11788050 - 11788107
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||| | || || ||||||| |||||||||||| ||||||||||||| |
|
|
| T |
11788050 |
ttggctaaaatatgatgttgatctctgcaaaaatgtctcgttttcgttttagtccctg |
11788107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #207
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 38231429 - 38231486
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||| || |||||| |||||||||||| |
|
|
| T |
38231429 |
ttggctaaaatatgattttgatccctgcaaatataccttgttttgattttagtccctg |
38231486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #208
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 176 - 213
Target Start/End: Original strand, 41451916 - 41451953
Alignment:
| Q |
176 |
tccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
41451916 |
tccctgcaaatatgtctcattttggttttggtccctgg |
41451953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #209
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 164 - 208
Target Start/End: Original strand, 1295190 - 1295234
Alignment:
| Q |
164 |
atatggttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
||||| |||| |||| || |||||||||||||||||||||||||| |
|
|
| T |
1295190 |
atatgattttggtccatgtaaatatgtctcgttttggttttagtc |
1295234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #210
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 156 - 188
Target Start/End: Original strand, 2411261 - 2411293
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatat |
188 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
2411261 |
tggctaaaatatgcttttagtccctgcaaatat |
2411293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #211
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 170 - 214
Target Start/End: Complemental strand, 5164423 - 5164379
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctggt |
214 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
5164423 |
ttttggtccatgcaaatatgtctcgttttggttttggtctctggt |
5164379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #212
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 157 - 205
Target Start/End: Original strand, 13802486 - 13802534
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
205 |
Q |
| |
|
|||||||||||||||||||| | || |||||| ||||||||||||||| |
|
|
| T |
13802486 |
ggctaaaatatggttttagttcttgtaaatattcctcgttttggtttta |
13802534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #213
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 157 - 185
Target Start/End: Complemental strand, 29311628 - 29311600
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaa |
185 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
29311628 |
ggctaaaatatggttttagtccctgcaaa |
29311600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #214
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 157 - 185
Target Start/End: Complemental strand, 42358871 - 42358843
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaa |
185 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
42358871 |
ggctaaaatatggttttagtccctgcaaa |
42358843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0370 (Bit Score: 78; Significance: 4e-36; HSPs: 1)
Name: scaffold0370
Description:
Target: scaffold0370; HSP #1
Raw Score: 78; E-Value: 4e-36
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 289 - 208
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
289 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccc |
208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 76; Significance: 6e-35; HSPs: 210)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 76; E-Value: 6e-35
Query Start/End: Original strand, 155 - 238
Target Start/End: Original strand, 1006833 - 1006916
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
1006833 |
ttggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccc |
1006916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 69; E-Value: 9e-31
Query Start/End: Original strand, 157 - 233
Target Start/End: Complemental strand, 44509054 - 44508978
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttg |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
44509054 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaattgtttttg |
44508978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 155 - 238
Target Start/End: Original strand, 44508718 - 44508800
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
44508718 |
ttggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaa-aaaaatttgtttttggtccc |
44508800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 6108334 - 6108416
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaa-ttgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
6108334 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaatttgtttttggtccc |
6108416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 155 - 237
Target Start/End: Complemental strand, 25547492 - 25547411
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtcc |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
25547492 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccct-gtaaaaaaaaaattgtttttggtcc |
25547411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 39832906 - 39832985
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
39832906 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccct-gtaaa-aaaaaattgtttttggtccc |
39832985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 44344789 - 44344710
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
44344789 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccct-gtaaa-aaaaaattgtttttggtccc |
44344710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 153 - 237
Target Start/End: Original strand, 13769770 - 13769852
Alignment:
| Q |
153 |
aattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtcc |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||| ||||||||||||||||||| |
|
|
| T |
13769770 |
aattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt-ccttgtaaa-aaaaaattgtttttggtcc |
13769852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 156 - 238
Target Start/End: Complemental strand, 1007230 - 1007148
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| ||||||||| ||||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
1007230 |
tggctaaaatatggttttagtccctccaaatatgcctcgttttgattttagtccttggtaaaaaaaaaattgtttttggtccc |
1007148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 6509470 - 6509390
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| ||||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
6509470 |
ggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccct-gtaaaaaaaaaattgtttttggtccc |
6509390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 154 - 238
Target Start/End: Original strand, 7431948 - 7432033
Alignment:
| Q |
154 |
attggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt-aaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| ||| |||||||||||||||||||| |
|
|
| T |
7431948 |
attggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtctttggtaaaaaaaaaaattgtttttggtccc |
7432033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 28911906 - 28911827
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
28911906 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct-gtaaa-aaaaaattgtttttggtccc |
28911827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 37372904 - 37372824
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||| ||| ||||| |||||||||||||||||||| |
|
|
| T |
37372904 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtacct-gtaaaaaaaaaattgtttttggtccc |
37372824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 155 - 236
Target Start/End: Complemental strand, 44403251 - 44403171
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtc |
236 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
44403251 |
ttggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccct-ataaaaaaaaaattgtttttggtc |
44403171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 45073641 - 45073561
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| ||||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
45073641 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccct-gtaaaaaaaaaattgtttttggtccc |
45073561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 157 - 237
Target Start/End: Complemental strand, 14739004 - 14738925
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtcc |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
14739004 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttgattttagtccctggtaaa-aaaaaattgtttttggtcc |
14738925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 17999721 - 17999643
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
17999721 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct-gtaa--aaaaaattgtttttggtccc |
17999643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 152 - 238
Target Start/End: Original strand, 19783810 - 19783896
Alignment:
| Q |
152 |
aaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||| || ||| ||||| |||||||||||||| |
|
|
| T |
19783810 |
aaataggctaaaatatagttttagtccctgcaaatatgtctcgttttggttttagtccttgtaaaaaaaaaatttgtttttggtccc |
19783896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 21554753 - 21554672
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || |||||| |||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
21554753 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttgattttagtccctgtaaaaaaaaaaattgtttttggtccc |
21554672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 150 - 238
Target Start/End: Original strand, 28911570 - 28911659
Alignment:
| Q |
150 |
ttaaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg-gtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| |||||||| ||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
28911570 |
ttaaataggctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagtccctgtaaaaaaaaaaaattgtttttggtccc |
28911659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 31310365 - 31310446
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| ||||||||||||||||||| ||| ||| |||||||||||||||||||| |
|
|
| T |
31310365 |
ggctaaaatatgattttagtccctgcaaatatttctcgttttggttttagtctctgtaaaaaaaaaaattgtttttggtccc |
31310446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 161 - 238
Target Start/End: Original strand, 37372441 - 37372518
Alignment:
| Q |
161 |
aaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||| |||||||||||||| |
|
|
| T |
37372441 |
aaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaactttgtttttggtccc |
37372518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 157 - 237
Target Start/End: Complemental strand, 1559705 - 1559626
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtcc |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| ||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
1559705 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttaattttagtccct-gtaaaaaaaaaattgtttttggtcc |
1559626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 158 - 238
Target Start/End: Original strand, 6079810 - 6079888
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| ||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
6079810 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccct-gtaaa-aaaaaattgtttttggtccc |
6079888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 158 - 238
Target Start/End: Original strand, 18022368 - 18022447
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| ||| |||| |||||||||||||||||||| |
|
|
| T |
18022368 |
gctaaaatatggttttagtccccgcaaatatgtctcgttttggttttagttcct-ataaaaaaaaaattgtttttggtccc |
18022447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 156 - 238
Target Start/End: Original strand, 1974008 - 1974087
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||| ||||| |||||||||||||| |
|
|
| T |
1974008 |
tggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccct-gtaa--aaaaatttgtttttggtccc |
1974087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 157 - 235
Target Start/End: Complemental strand, 12894402 - 12894323
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg-gtaaataaaaaattgtttttggt |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
12894402 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaaaattgtttttggt |
12894323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 19561450 - 19561395
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19561450 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
19561395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 35210515 - 35210460
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35210515 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
35210460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 154 - 238
Target Start/End: Complemental strand, 39833239 - 39833154
Alignment:
| Q |
154 |
attggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaa--ttgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||| ||||| |||||| |||||||||||||| |
|
|
| T |
39833239 |
attggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccct-gtaaagaaaaaactttgtttttggtccc |
39833154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 152 - 238
Target Start/End: Complemental strand, 45021861 - 45021774
Alignment:
| Q |
152 |
aaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaa-aattgtttttggtccc |
238 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| ||| ||||||||||||| | ||||||| |||| |||||||||||||||| |
|
|
| T |
45021861 |
aaataggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagttcatggtaaaaaaaataattgtttttggtccc |
45021774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 155 - 238
Target Start/End: Complemental strand, 48359077 - 48358996
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||| ||||||||||||||| |||| |
|
|
| T |
48359077 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt-tcttgtaaa-aaaaaattgtttttgatccc |
48358996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 8555799 - 8555717
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaata-aaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||| |||||| ||| | ||||||||||||||||||| |
|
|
| T |
8555799 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctgtaaaaaacaaaaattgtttttggtccc |
8555717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 20388274 - 20388355
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaat-tgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || |||||||||||||||||| ||||| ||||||| ||||||||||||| |
|
|
| T |
20388274 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccct-gtaaaaaaaaaatctgtttttggtccc |
20388355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 23816670 - 23816752
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg-gtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||| ||| ||| |||||||||||||||||||| |
|
|
| T |
23816670 |
ggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtctctgtaaaaaaaaaaaattgtttttggtccc |
23816752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 156 - 238
Target Start/End: Complemental strand, 30352905 - 30352824
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
30352905 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttgattttagtccctggtaaa-aaaaaaaagtttttggtccc |
30352824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 35015220 - 35015138
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaa-aattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
35015220 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctggtaaaaaaaatttttgtttttggtccc |
35015138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 23817034 - 23816954
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||| ||| ||||||||||||||||||| ||||| ||| ||||| |||||||||||||||||||| |
|
|
| T |
23817034 |
ggctaaaatatggttttagtctctgtaaatatgtctcgttttggtattagttcct-gtaaaaaaaaaattgtttttggtccc |
23816954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 154 - 238
Target Start/End: Original strand, 31732098 - 31732180
Alignment:
| Q |
154 |
attggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||| ||||| ||||| ||||| |||||| ||||||||||||| |
|
|
| T |
31732098 |
attggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttaatccct-gtaaa-aaaaaaatgtttttggtccc |
31732180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 157 - 229
Target Start/End: Complemental strand, 35838337 - 35838267
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtt |
229 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
35838337 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct-gtaaa-aaaaaattgtt |
35838267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 1614559 - 1614614
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1614559 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
1614614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 8144295 - 8144350
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8144295 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
8144350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 156 - 238
Target Start/End: Complemental strand, 10358369 - 10358286
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaa-aattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |||||||||||||||||||||| ||| |||| ||||| |||||||||| |
|
|
| T |
10358369 |
tggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaagaattgattttggtccc |
10358286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 157 - 236
Target Start/End: Complemental strand, 13770081 - 13770003
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtc |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | ||||||||||||||| ||| ||||| ||||| |||||||||||| |
|
|
| T |
13770081 |
ggctaaaatatggttttagtccctgcaaatatgccccgttttggttttagttcct-gtaaaaaaaaatttgtttttggtc |
13770003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 155 - 222
Target Start/End: Complemental strand, 16853591 - 16853525
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaa |
222 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
16853591 |
ttggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccct-gtaaataaaa |
16853525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 19757748 - 19757803
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
19757748 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
19757803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 155 - 238
Target Start/End: Original strand, 21554391 - 21554472
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||| ||||||||||||||||| ||| ||||| |||||||||||||||||||| |
|
|
| T |
21554391 |
ttggctaaaatatgattttagtccctgaaaatatgcctcgttttggttttagt-ccttgtaaa-aaaaaattgtttttggtccc |
21554472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 23399976 - 23399921
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23399976 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
23399921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 25092160 - 25092215
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25092160 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
25092215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 25988385 - 25988440
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25988385 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
25988440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 27458399 - 27458454
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27458399 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
27458454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 154 - 238
Target Start/End: Complemental strand, 46304387 - 46304301
Alignment:
| Q |
154 |
attggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaa--ttgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||| ||| |||||| |||||||| ||||| |
|
|
| T |
46304387 |
attggctaaaatatagttttagtccctgcaaatatgtttcgttttggttttagtccctgtaaaaaaaaaaaatttgttttttgtccc |
46304301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 489072 - 488994
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||||||| ||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
489072 |
ggctaaaatatgattttagtctctgcaaatatgtctcgttttgattttagtccct-gtaa--aaaaaattgtttttggtccc |
488994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 155 - 238
Target Start/End: Original strand, 5308321 - 5308406
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaa--ttgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||| ||| |||||| ||||||||| |||| |
|
|
| T |
5308321 |
ttggctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtccctgtaaaaaaaaaaaatttgtttttgatccc |
5308406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 18022704 - 18022622
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaa-aaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||||||||||||| || ||| ||| ||||||||||||||||| |
|
|
| T |
18022704 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccttgtaaaaaaaataaattgtttttggtccc |
18022622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 160 - 238
Target Start/End: Original strand, 30709328 - 30709405
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||| ||||||||||| |||||||| ||||||||||||||||| ||| ||||| |||||||||||||||||||| |
|
|
| T |
30709328 |
taaaatatgattttagtccctacaaatatgcctcgttttggttttagt-ccttgtaaaaaaaaaattgtttttggtccc |
30709405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 159 - 237
Target Start/End: Complemental strand, 32189388 - 32189310
Alignment:
| Q |
159 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtcc |
237 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||||||||||||||||| ||| |||||| | |||||||||| |
|
|
| T |
32189388 |
ctaaaatatggttttagtctctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaaaatatttttggtcc |
32189310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 5308686 - 5308606
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| |||||||||||||||||||||| ||| ||||| |||||||||||||| |
|
|
| T |
5308686 |
ggctaaaatatg-ttttagtccctgcaaatatacctcgttttggttttagtccctgtaaaaaaaaaatttgtttttggtccc |
5308606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 159 - 212
Target Start/End: Original strand, 17854151 - 17854204
Alignment:
| Q |
159 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
17854151 |
ctaaaatatggttttagtccctgcaaatatgtctcattttggttttagtccctg |
17854204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 157 - 226
Target Start/End: Complemental strand, 39719642 - 39719574
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaatt |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| |||||||||||| ||||| |||||||| |
|
|
| T |
39719642 |
ggctaaaatatggttttagtccctgcaaatatggctcgttttagttttagtccct-gtaaacaaaaaatt |
39719574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 147 - 212
Target Start/End: Complemental strand, 46829322 - 46829257
Alignment:
| Q |
147 |
attttaaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||| |||||||||||||||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
46829322 |
attttaaaatggctaaaatatggttttgatccctgcaaatatgtctcattttggttttagtccctg |
46829257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 157 - 229
Target Start/End: Complemental strand, 5234204 - 5234134
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtt |
229 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
5234204 |
ggctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtccct-gtaaa-aaaaaattgtt |
5234134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 145 - 212
Target Start/End: Complemental strand, 9659699 - 9659634
Alignment:
| Q |
145 |
atattttaaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||| ||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
9659699 |
atattttaaa--ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
9659634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 160 - 212
Target Start/End: Original strand, 23676135 - 23676187
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23676135 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
23676187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 160 - 216
Target Start/End: Original strand, 30352563 - 30352619
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
30352563 |
taaaatatggttttagtccctgcaaatatgcctcgttttggtttcagtccctggtaa |
30352619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 35837924 - 35837976
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
35837924 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
35837976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 156 - 238
Target Start/End: Original strand, 45021493 - 45021577
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgtttt-ggttttagtccctggtaaataaaa-aattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| |||||||||||||| |||| |||| | ||||||||| |||| |
|
|
| T |
45021493 |
tggctaaaatatggttttagtccctgcaaatatgcctcgttttgggttttagtccctgctaaaaaaaacatttgtttttgctccc |
45021577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 157 - 237
Target Start/End: Complemental strand, 46648715 - 46648636
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtcc |
237 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| ||||||||||||||| | ||| ||||| ||||| ||||||||||||| |
|
|
| T |
46648715 |
ggctaaaatatggttttagtctctgcaaatatgcctcgttttggttttaat-ccttgtaaaaaaaaatttgtttttggtcc |
46648636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 46759658 - 46759710
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
46759658 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
46759710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 163 - 238
Target Start/End: Original strand, 488720 - 488794
Alignment:
| Q |
163 |
aatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| |||||||| || ||| |||||||||||||||||||| |
|
|
| T |
488720 |
aatatggttttagtccttgcaaatatgtctcgttttgg-tttagtccttgtaaaaaaaaaaattgtttttggtccc |
488794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 1614904 - 1614849
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
1614904 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
1614849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 3975549 - 3975604
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3975549 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
3975604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 6509208 - 6509263
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
6509208 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttcgttttagtccctg |
6509263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 8144658 - 8144603
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
8144658 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
8144603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 152 - 238
Target Start/End: Original strand, 10357996 - 10358084
Alignment:
| Q |
152 |
aaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaa---ttgtttttggtccc |
238 |
Q |
| |
|
|||| |||||||||||| | |||||||||||||||||| ||||||||||||||||||||| ||||| |||||| |||||||||||||| |
|
|
| T |
10357996 |
aaataggctaaaatatgatcttagtccctgcaaatatgcctcgttttggttttagtccct-gtaaaaaaaaaagttttgtttttggtccc |
10358084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 17999465 - 17999520
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
17999465 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttcgtccctg |
17999520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 156 - 207
Target Start/End: Original strand, 19561153 - 19561204
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
19561153 |
tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
19561204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 23399612 - 23399667
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
23399612 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
23399667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 23676452 - 23676397
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
23676452 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
23676397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 25988749 - 25988694
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
25988749 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
25988694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 26878071 - 26878016
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
26878071 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
26878016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 29198303 - 29198358
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29198303 |
ggctaaaatatggttttggtccctgcaaatatatctcgttttggttttagtccctg |
29198358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 29198662 - 29198607
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
29198662 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
29198607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 30223461 - 30223516
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
30223461 |
ggctaaaatatggttttggtccccgcaaatatgtctcgttttggttttagtccctg |
30223516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #85
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 208
Target Start/End: Complemental strand, 30709644 - 30709593
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30709644 |
ggctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtc |
30709593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #86
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 39439029 - 39438974
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
39439029 |
ggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtccctg |
39438974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #87
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 158 - 237
Target Start/End: Complemental strand, 41365213 - 41365134
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtcc |
237 |
Q |
| |
|
||||||||||||||||||| || ||||||||| ||||||||||||||||| ||| ||| ||||||||||||||||||| |
|
|
| T |
41365213 |
gctaaaatatggttttagttcccgcaaatatgcctcgttttggttttagtttctgtaaaaaaaaaaattgtttttggtcc |
41365134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #88
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 159 - 237
Target Start/End: Original strand, 43058752 - 43058827
Alignment:
| Q |
159 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtcc |
237 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |||||| ||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
43058752 |
ctaaaatatagttttagtccctgcaaatatgtcttgttttgattttagtccct-gtaa--aaaaaattgtttttggtcc |
43058827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #89
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 158 - 209
Target Start/End: Original strand, 43300613 - 43300664
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
43300613 |
gctaaaatatggttttagttcctgcaaatatgtctcgttttggttttagtcc |
43300664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #90
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 44568690 - 44568635
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44568690 |
ggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
44568635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #91
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 45228918 - 45228863
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
45228918 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
45228863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #92
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 46759942 - 46759887
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46759942 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtccctg |
46759887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #93
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 46828944 - 46828999
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
46828944 |
ggctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtccctg |
46828999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #94
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 48192488 - 48192433
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
48192488 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
48192433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #95
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 172 - 238
Target Start/End: Original strand, 12894056 - 12894121
Alignment:
| Q |
172 |
ttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||| ||||| |||||||||||||||||||| |
|
|
| T |
12894056 |
ttagtccctgcaaatatgcctcgttttggttttaatccct-gtaaaaaaaaaattgtttttggtccc |
12894121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #96
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 19465980 - 19465899
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg-gtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||| |||||||||||||| ||| ||||| |||||||||||||| |
|
|
| T |
19465980 |
ggctaaaatatggttttag-ccctgcaaatatgtctcgtttcggttttagtccctgtaaaaagaaaaatttgtttttggtccc |
19465899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #97
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 157 - 211
Target Start/End: Complemental strand, 21223748 - 21223694
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccct |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
21223748 |
ggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtccct |
21223694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #98
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 44402960 - 44403042
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg-gtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | | |||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
44402960 |
ggctaaaatatggttttagtccctgcaaatatgccccattttggttttagtccctgtaaaaataaaattttgtttttggtccc |
44403042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #99
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 45073314 - 45073396
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg-gtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||| | ||||||||||||||| |||||| |||||||| |||||||||||||| |
|
|
| T |
45073314 |
ggctaaaatatggttttagtccctgcaaataagcctcgttttggttttaatccctgtaaaaataaaattttgtttttggtccc |
45073396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #100
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 160 - 237
Target Start/End: Original strand, 14738603 - 14738679
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtcc |
237 |
Q |
| |
|
|||||||| |||||||||||||||||||| ||| ||||||||||||| ||||||||| ||||| ||||||||||||| |
|
|
| T |
14738603 |
taaaatattattttagtccctgcaaatatgcctcattttggttttagt-cctggtaaaaaaaaatttgtttttggtcc |
14738679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #101
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 157 - 237
Target Start/End: Original strand, 41364884 - 41364965
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg-gtaaataaaaaattgtttttggtcc |
237 |
Q |
| |
|
|||||||||||||||||| || || ||||||||||||||||||||||||||||||| | ||| || || ||||||||||||| |
|
|
| T |
41364884 |
ggctaaaatatggttttaatctctacaaatatgtctcgttttggttttagtccctgtgaaaaaaataatttgtttttggtcc |
41364965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #102
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 3975838 - 3975786
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
3975838 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
3975786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #103
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 152 - 212
Target Start/End: Original strand, 9659350 - 9659410
Alignment:
| Q |
152 |
aaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||||||||||||||||| |||||||||||| |
|
|
| T |
9659350 |
aaataggctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtccctg |
9659410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #104
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 14543710 - 14543762
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
14543710 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
14543762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #105
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 158 - 238
Target Start/End: Original strand, 18311581 - 18311661
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||| || |||||||| ||||||||||||||| || ||| ||| ||||||||||||||| |||| |
|
|
| T |
18311581 |
gctaaaatatggttttagtctctacaaatatgcctcgttttggttttattctctgtaaaaaaaaaaattgtttttgatccc |
18311661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #106
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 152 - 208
Target Start/End: Complemental strand, 18927096 - 18927040
Alignment:
| Q |
152 |
aaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
18927096 |
aaattggctaaaatatagttttagtccctgcaaatatgtctcattttagttttagtc |
18927040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #107
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 156 - 212
Target Start/End: Original strand, 27037592 - 27037648
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
27037592 |
tggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctg |
27037648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #108
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 160 - 208
Target Start/End: Complemental strand, 31503780 - 31503732
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
31503780 |
taaaatatggttttagtccctgcaaatatgtctcgttttgattttagtc |
31503732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #109
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 160 - 212
Target Start/End: Original strand, 48192260 - 48192312
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
48192260 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
48192312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #110
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 5233808 - 5233863
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
5233808 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
5233863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #111
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 5354768 - 5354823
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
5354768 |
ggctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtccctg |
5354823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #112
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 156 - 211
Target Start/End: Complemental strand, 24717533 - 24717478
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccct |
211 |
Q |
| |
|
|||||||||||||||||| |||||| | |||||||||||||||||||||||||||| |
|
|
| T |
24717533 |
tggctaaaatatggttttggtccctaccaatatgtctcgttttggttttagtccct |
24717478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #113
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 25092548 - 25092493
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
25092548 |
ggctaaaatatggttttggtccctgcaaatatgcctctttttggttttagtccctg |
25092493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #114
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 26877678 - 26877733
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
26877678 |
ggctaaaatatggttttgatctctgcaaatatgtctcgttttggttttagtccctg |
26877733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #115
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 160 - 211
Target Start/End: Original strand, 34877777 - 34877828
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccct |
211 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
34877777 |
taaaatatggttttggtccctgtaaatatgtctcgttttggttttagtccct |
34877828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #116
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 35104078 - 35104133
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35104078 |
ggctaaaatataattttggtccctgcaaatatgtctcgttttggttttagtccctg |
35104133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #117
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 35104295 - 35104240
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
35104295 |
ggctcaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
35104240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #118
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 35665877 - 35665932
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
35665877 |
ggctaaaatatggttttaatccctacaaatatgcctcgttttggttttagtccctg |
35665932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #119
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 39520398 - 39520453
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| |||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
39520398 |
ggctaaaatatggttttggtccatccaaatatgtctcgttttggttttagtccctg |
39520453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #120
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 41054236 - 41054181
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
41054236 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg |
41054181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #121
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 44568326 - 44568381
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
44568326 |
ggctaaaatatggttttggtccctgcaaatataactcgttttggttttagtccctg |
44568381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #122
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 44958506 - 44958451
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||| |||| |||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
44958506 |
ggctaaaatatgattttggtccctacaaatatgtctcgttttggttttagtccctg |
44958451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #123
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 1559343 - 1559425
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaa-aaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| ||||||||| ||||| |||||| |||| ||| | |||||||||||||| |
|
|
| T |
1559343 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttgattttaatccctgttaaaaaaacattttgtttttggtccc |
1559425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #124
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 155 - 209
Target Start/End: Original strand, 6589019 - 6589073
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||| |||| |
|
|
| T |
6589019 |
ttggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtcc |
6589073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #125
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 160 - 226
Target Start/End: Complemental strand, 7432249 - 7432183
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaatt |
226 |
Q |
| |
|
||||||||||||||| | |||||||||||| ||||||||| |||||||| |||||||| |||||||| |
|
|
| T |
7432249 |
taaaatatggttttaattcctgcaaatatgcctcgttttgattttagtctctggtaaaaaaaaaatt |
7432183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #126
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 157 - 235
Target Start/End: Complemental strand, 31732451 - 31732373
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggt |
235 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||||||||| |||||| || || ||| |||||| |||||||||| |
|
|
| T |
31732451 |
ggctaaaatatggttttagtccatgcaaatatgcctcgttttgattttagcccttgtaaaaaaaaaaaatgtttttggt |
31732373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #127
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 158 - 212
Target Start/End: Complemental strand, 37527421 - 37527367
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
37527421 |
gctaaaatatggttttggtccctccaaatatgtcttgttttggttttagtccctg |
37527367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #128
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 16941054 - 16940997
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
16941054 |
ttggataaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg |
16940997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #129
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 155 - 208
Target Start/End: Complemental strand, 18891567 - 18891514
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
18891567 |
ttggttaaaatatggttttagtccctgcaaatatgtctcgttttaattttagtc |
18891514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #130
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 172 - 237
Target Start/End: Complemental strand, 19758044 - 19757981
Alignment:
| Q |
172 |
ttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtcc |
237 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
19758044 |
ttagtccctgcaaatatgcctcattttggttttagtccct-gtaaa-aaaaaattgtttttggtcc |
19757981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #131
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 157 - 235
Target Start/End: Original strand, 21223405 - 21223485
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg--gtaaataaaaaattgtttttggt |
235 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||||||||||| ||| ||| ||||||||||||||||| |
|
|
| T |
21223405 |
ggctaaaatatgattttagtccctgcaaatatgcttcgttttggttttagtctctgtaaaaaaaaaaaaattgtttttggt |
21223485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #132
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 159 - 212
Target Start/End: Original strand, 37952671 - 37952724
Alignment:
| Q |
159 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
37952671 |
ctaaaatatggttttagtccctgtaaatatgtcttattttggttttagtccctg |
37952724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #133
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 156 - 238
Target Start/End: Original strand, 39719352 - 39719435
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaa--ttgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| ||| |||||||||||||| || ||||| | |||| |||||||||||||| |
|
|
| T |
39719352 |
tggctaaaatatggttttagtccctacaaatatgcctcattttggttttagtctct-gtaaaaagaaaattttgtttttggtccc |
39719435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #134
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 160 - 233
Target Start/End: Complemental strand, 45671545 - 45671473
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttg |
233 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |||||||||||| ||| ||||||||||||||| |
|
|
| T |
45671545 |
taaaatatggttttagtcattgcaaatatgtctcgttttagttttagtccct-aaaaaaaaaaaattgtttttg |
45671473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #135
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 148 - 212
Target Start/End: Original strand, 28262704 - 28262768
Alignment:
| Q |
148 |
ttttaaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||| ||| ||||||||||||||||| ||||||||||||||| ||| ||||||||||| |||||| |
|
|
| T |
28262704 |
ttttgaataggctaaaatatggttttggtccctgcaaatatgcctcattttggttttaatccctg |
28262768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #136
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 30223795 - 30223743
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
||||||||||||||||| |||| |||||||||| ||||||||||||||||||| |
|
|
| T |
30223795 |
ggctaaaatatggttttggtccatgcaaatatgcctcgttttggttttagtcc |
30223743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #137
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 157 - 205
Target Start/End: Complemental strand, 34878125 - 34878077
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
205 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
34878125 |
ggctaaaatatggttttgatccctgcaaatatgtctcgttttggtttta |
34878077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #138
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 156 - 208
Target Start/End: Original strand, 35469879 - 35469931
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
35469879 |
tggctaaaatatggttttgatccctgcaaatatgtttcgttttggttttagtc |
35469931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #139
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 160 - 208
Target Start/End: Complemental strand, 37953048 - 37953000
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
37953048 |
taaaatatggttttagtccctgtaaatatgtcttgttttggttttagtc |
37953000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #140
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 160 - 212
Target Start/End: Complemental strand, 39520727 - 39520675
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
39520727 |
taaaatatggttttggtccttgcaaatatgtctcgttttgattttagtccctg |
39520675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #141
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 160 - 212
Target Start/End: Original strand, 45671217 - 45671269
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| |||||||| |||| |
|
|
| T |
45671217 |
taaaatatggttttagtccatgcaaatatgtctcgttttagttttagttcctg |
45671269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #142
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 46304086 - 46304138
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
46304086 |
ggctaaaatatgattttagttcctgcaaatatgcctcgttttggttttagtcc |
46304138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #143
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 48852444 - 48852496
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||| |||||||||| |
|
|
| T |
48852444 |
ggctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtcc |
48852496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #144
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 148 - 212
Target Start/End: Complemental strand, 48854079 - 48854015
Alignment:
| Q |
148 |
ttttaaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||| |||||||||||| |||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
48854079 |
ttttaaaaaggctaaaatatgattttgatccctgcaaatatgtttcgttttggttttagtccctg |
48854015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #145
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 2945845 - 2945790
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||| |||| |||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
2945845 |
ggctaaaatatgtttttggtccctacaaatatgcctcgttttggttttagtccctg |
2945790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #146
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 3807864 - 3807919
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||| ||||| || |||||||||||||||||||||||||||||| |||| |
|
|
| T |
3807864 |
ggctaaaatatagttttggttcctgcaaatatgtctcgttttggttttagttcctg |
3807919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #147
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 6892260 - 6892205
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||| ||||||| ||||||||||| |
|
|
| T |
6892260 |
ggctaaaatatggttttggtccctgcaaaaatgtcttgttttgggtttagtccctg |
6892205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #148
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 161 - 208
Target Start/End: Original strand, 6954862 - 6954909
Alignment:
| Q |
161 |
aaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
||||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
6954862 |
aaaatatggttttggtccctgcaaatatatctcgttttggttttagtc |
6954909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #149
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 160 - 211
Target Start/End: Original strand, 11766920 - 11766971
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccct |
211 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
11766920 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttcgtccct |
11766971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #150
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 11767275 - 11767220
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| || |||||||||||||||||| |
|
|
| T |
11767275 |
ggctaaaatatggttttggtccctgcaaatatgcttcattttggttttagtccctg |
11767220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #151
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 12932783 - 12932728
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
12932783 |
ggctaaaatatgtttttggtccctgcaaatatgcctcgttttgattttagtccctg |
12932728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #152
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 16940762 - 16940817
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
16940762 |
ggctaacatatggttttggtccctgcaaatatgcctcggtttggttttagtccctg |
16940817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #153
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 160 - 207
Target Start/End: Original strand, 25547256 - 25547303
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
207 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
25547256 |
taaaatatggttttaatccctgcaaatatgcctcgttttggttttagt |
25547303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #154
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 28528905 - 28528960
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| || |||| ||||||||||||||| |||||||||||||| |
|
|
| T |
28528905 |
ggctaaaatatggttttggttcctgtaaatatgtctcgtttgggttttagtccctg |
28528960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #155
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 157 - 224
Target Start/End: Original strand, 35210182 - 35210249
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaa |
224 |
Q |
| |
|
|||||||||||| |||| |||| ||||||||| |||||||||||||||||||||| |||| |||||| |
|
|
| T |
35210182 |
ggctaaaatatgattttgatcccggcaaatatgactcgttttggttttagtccctgttaaaaaaaaaa |
35210249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #156
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 157 - 208
Target Start/End: Original strand, 39438741 - 39438792
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||| |||||||||||||||||| |
|
|
| T |
39438741 |
ggctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtc |
39438792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #157
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 41053842 - 41053897
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| ||||| |||||||||||| |
|
|
| T |
41053842 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttgattttagtccctg |
41053897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #158
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 166 - 212
Target Start/End: Complemental strand, 1271590 - 1271544
Alignment:
| Q |
166 |
atggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
1271590 |
atggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
1271544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #159
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 160 - 238
Target Start/End: Complemental strand, 6589271 - 6589194
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || |||||||||||||||| | ||||| ||| |||||||||||||| |
|
|
| T |
6589271 |
taaaatatggttttggtccctgcaaatatgccttgttttggttttagtccat-gtaaaaaaattgttgtttttggtccc |
6589194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #160
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 156 - 226
Target Start/End: Complemental strand, 20388676 - 20388606
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaatt |
226 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||||| ||||||||| ||||||| |||| ||| |||||||| |
|
|
| T |
20388676 |
tggctaaaatatggttttagtcgctgaaaatatgcctcgttttgattttagttcctgtaaaaaaaaaaatt |
20388606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #161
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 157 - 203
Target Start/End: Complemental strand, 31310679 - 31310633
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
31310679 |
ggctaaaatatggttttagtccctgcaaatatgcatcgttttggttt |
31310633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #162
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 155 - 205
Target Start/End: Original strand, 32189074 - 32189124
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
205 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
32189074 |
ttggctaaaatatgattttagtccctgcaaatatgcttcgttttggtttta |
32189124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #163
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 157 - 227
Target Start/End: Original strand, 35212068 - 35212138
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattg |
227 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| | |||| |||||| |||||||||||| ||||||||| |
|
|
| T |
35212068 |
ggctaaaatatgtttttggtccctgcaaatatgacgagtttgggttttggtccctggtaaaaaaaaaattg |
35212138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #164
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 159 - 208
Target Start/End: Complemental strand, 6847117 - 6847068
Alignment:
| Q |
159 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
6847117 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtc |
6847068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #165
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 155 - 204
Target Start/End: Complemental strand, 28529211 - 28529162
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttt |
204 |
Q |
| |
|
|||| |||||||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
28529211 |
ttggttaaaatatggttttggtctctgcaaatatgtctcgttttggtttt |
28529162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #166
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 160 - 208
Target Start/End: Complemental strand, 5355114 - 5355066
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
|||| ||||||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
5355114 |
taaagtatggttttggtccctgcaaatatgcctcgttttggttttagtc |
5355066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #167
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 160 - 212
Target Start/End: Original strand, 31503423 - 31503475
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||| | ||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
31503423 |
taaaatatggttttggcccctgtaaatatgtctctttttggttttagtccctg |
31503475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #168
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 35470280 - 35470198
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaa--attgtttttggtccc |
238 |
Q |
| |
|
||||||||| ||||||| |||||||||||||| ||| ||||||||||||||||| ||||| ||||| ||||||||| ||||| |
|
|
| T |
35470280 |
ggctaaaatttggttttgatccctgcaaatatgcctcattttggttttagtccct-gtaaaaaaaaattattgttttttgtccc |
35470198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #169
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 160 - 212
Target Start/End: Original strand, 38186369 - 38186421
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||||| |||||| ||||| |
|
|
| T |
38186369 |
taaaatatggttttggtccctgcaaatatgcctcgttttgattttaggccctg |
38186421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #170
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 157 - 208
Target Start/End: Complemental strand, 38186761 - 38186709
Alignment:
| Q |
157 |
ggctaaaatatggttttag-tccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
|||||||||||| |||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
38186761 |
ggctaaaatatgatttttggtccctgcaaatatgtctcgttttggttttagtc |
38186709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #171
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 157 - 205
Target Start/End: Original strand, 44344457 - 44344505
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
205 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||||||| ||||||| |
|
|
| T |
44344457 |
ggctaaaatatggttttagttcccgcaaatatgtctcgtttcggtttta |
44344505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #172
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 160 - 212
Target Start/End: Original strand, 44841359 - 44841411
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
44841359 |
taaaatatggttttgatccctgcaaatatgcctcgttttgattttagtccctg |
44841411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #173
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 45228615 - 45228670
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| | ||| ||||||||| |||||||| ||||||||||||| |
|
|
| T |
45228615 |
ggctaaaatatggttttgggccccgcaaatatgcctcgtttttgttttagtccctg |
45228670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #174
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 170 - 208
Target Start/End: Complemental strand, 3808106 - 3808068
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
3808106 |
ttttggtccctgcaaatatgtctcgttttggttttagtc |
3808068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #175
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 155 - 205
Target Start/End: Complemental strand, 6911249 - 6911199
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
205 |
Q |
| |
|
||||||||||||||||||| || ||||||||||| ||||||||||||||| |
|
|
| T |
6911249 |
ttggctaaaatatggttttggttcctgcaaatatacctcgttttggtttta |
6911199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #176
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 157 - 227
Target Start/End: Original strand, 17066425 - 17066495
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattg |
227 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||| | |||| |||||| |||||||||||| ||||||||| |
|
|
| T |
17066425 |
ggctaaaatatgcttttaatccctgcaaatatagcgagtttgggttttggtccctggtaaaaaaaaaattg |
17066495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #177
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 157 - 207
Target Start/End: Original strand, 19005598 - 19005648
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
207 |
Q |
| |
|
||||||||||| ||||| ||||||| ||||||||||||||||| ||||||| |
|
|
| T |
19005598 |
ggctaaaatatagttttggtccctgtaaatatgtctcgttttgattttagt |
19005648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #178
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 157 - 207
Target Start/End: Original strand, 38486478 - 38486528
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
207 |
Q |
| |
|
|||||||||||| |||| ||||||| |||||||||||||||| |||||||| |
|
|
| T |
38486478 |
ggctaaaatatgattttggtccctgtaaatatgtctcgttttagttttagt |
38486528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #179
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 159 - 212
Target Start/End: Original strand, 18926889 - 18926942
Alignment:
| Q |
159 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||||| | | |||||||| ||||||||||||| |||||||| |
|
|
| T |
18926889 |
ctaaaatatggttttagttcattcaaatatgactcgttttggtttaagtccctg |
18926942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #180
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 159 - 212
Target Start/End: Complemental strand, 28263069 - 28263016
Alignment:
| Q |
159 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||| ||||||||||||||| | |||||| |||||||||||| |
|
|
| T |
28263069 |
ctaaaatatggttttgatccctgcaaatatgtattgttttgattttagtccctg |
28263016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #181
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 170 - 210
Target Start/End: Complemental strand, 19005865 - 19005825
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccc |
210 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
19005865 |
ttttggtccctgcaaatatgtctcgttttggttttggtccc |
19005825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #182
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 165 - 209
Target Start/End: Original strand, 24953828 - 24953872
Alignment:
| Q |
165 |
tatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
24953828 |
tatggttttagtccctgcaaatatgcattgttttggttttagtcc |
24953872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #183
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 173 - 212
Target Start/End: Complemental strand, 3954178 - 3954139
Alignment:
| Q |
173 |
tagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
3954178 |
tagtctctgcatatatgtctcgttttggttttagtccctg |
3954139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #184
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 159 - 206
Target Start/End: Complemental strand, 20355768 - 20355721
Alignment:
| Q |
159 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttag |
206 |
Q |
| |
|
||||||||||||||||||||| | |||||||| ||||||| ||||||| |
|
|
| T |
20355768 |
ctaaaatatggttttagtccccgtaaatatgtttcgttttagttttag |
20355721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #185
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 22539930 - 22539985
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||| |||||||| ||| ||||||||||||| |||| |
|
|
| T |
22539930 |
ggctaaaatatggttttgatccctccaaatatgcctcattttggttttagttcctg |
22539985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #186
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 23399685 - 23399728
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
23399685 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgg |
23399728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #187
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 23676205 - 23676248
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
23676205 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgg |
23676248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #188
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 160 - 207
Target Start/End: Complemental strand, 24954147 - 24954100
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
207 |
Q |
| |
|
||||||||||| |||| ||||||||||||| |||||||||||||||| |
|
|
| T |
24954147 |
taaaatatggtcttagaccctgcaaatatgattcgttttggttttagt |
24954100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #189
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 25092233 - 25092276
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
25092233 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgg |
25092276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #190
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Complemental strand, 25988676 - 25988633
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
25988676 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgg |
25988633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #191
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 26877751 - 26877794
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
26877751 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgg |
26877794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #192
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Complemental strand, 27037860 - 27037817
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
27037860 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgg |
27037817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #193
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 29198376 - 29198419
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
29198376 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgg |
29198419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #194
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 157 - 208
Target Start/End: Complemental strand, 38486790 - 38486739
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
||||||||||||||||| |||||| ||||||| | |||||||||||||||| |
|
|
| T |
38486790 |
ggctaaaatatggttttgatccctgtaaatatgccccgttttggttttagtc |
38486739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #195
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 44568399 - 44568442
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
44568399 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgg |
44568442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #196
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 1271235 - 1271293
Alignment:
| Q |
154 |
attggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||| |||| |||||| |||||||||||||||| |||||| |||||| |
|
|
| T |
1271235 |
attggctaaaatattgtttcggtccctctaaatatgtctcgttttagttttaatccctg |
1271293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #197
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 170 - 204
Target Start/End: Complemental strand, 1271526 - 1271492
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggtttt |
204 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |
|
|
| T |
1271526 |
ttttagtccctgcaaatatgtctcgttttagtttt |
1271492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #198
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 24717225 - 24717283
Alignment:
| Q |
155 |
ttggctaaaatatggttttag-tccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||||| | |||||| ||||||||||| ||||| |||| ||||||| |
|
|
| T |
24717225 |
ttggctaaaatatggtttttggtccctgtaaatatgtctcattttgattttggtccctg |
24717283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #199
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 170 - 212
Target Start/End: Original strand, 35665948 - 35665990
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
35665948 |
ttttggtccttgcaaatatgtctcgttttggttttggtccctg |
35665990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #200
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 170 - 212
Target Start/End: Complemental strand, 41054163 - 41054121
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
41054163 |
ttttggtccctgcaaatatgcctcattttggttttagtccctg |
41054121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #201
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 170 - 204
Target Start/End: Original strand, 44841428 - 44841462
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggtttt |
204 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
44841428 |
ttttggtccctgcaaatatgtctcgttttggtttt |
44841462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #202
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 160 - 198
Target Start/End: Complemental strand, 44841711 - 44841673
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgtttt |
198 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
44841711 |
taaaatatggttttggtccctgcaaatatgactcgtttt |
44841673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #203
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 170 - 211
Target Start/End: Original strand, 1614632 - 1614673
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccct |
211 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
1614632 |
ttttggtccctgcaaatatgtctcattttggttttggtccct |
1614673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #204
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 157 - 210
Target Start/End: Original strand, 20355408 - 20355461
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccc |
210 |
Q |
| |
|
|||||||||||| |||| ||| |||||||||| |||||||||||| ||||||| |
|
|
| T |
20355408 |
ggctaaaatatgattttgatccttgcaaatatgactcgttttggttgtagtccc |
20355461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #205
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 157 - 222
Target Start/End: Complemental strand, 31848203 - 31848138
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaa |
222 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| | ||| |||||| |||||||||||| |||| |
|
|
| T |
31848203 |
ggctaaaatatgtttttagtccctgcaaatatagcgaatttgggttttggtccctggtaaaaaaaa |
31848138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #206
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 6911082 - 6911134
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
|||||||||||| |||| |||| | ||||||||||||||||| ||||||||| |
|
|
| T |
6911082 |
ggctaaaatatgattttggtccttataaatatgtctcgttttgattttagtcc |
6911134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #207
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 157 - 205
Target Start/End: Original strand, 8555607 - 8555655
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
205 |
Q |
| |
|
||||||||||| |||||||| ||||||||||| || |||||||||||| |
|
|
| T |
8555607 |
ggctaaaatatagttttagtttctgcaaatatgacttgttttggtttta |
8555655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #208
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 157 - 185
Target Start/End: Original strand, 35014928 - 35014956
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaa |
185 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
35014928 |
ggctaaaatatggttttagtccctgcaaa |
35014956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #209
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 157 - 205
Target Start/End: Original strand, 36684535 - 36684583
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
205 |
Q |
| |
|
||||||||||||| ||| ||| ||||||||| |||||||||||||||| |
|
|
| T |
36684535 |
ggctaaaatatggctttgatccatgcaaatatatctcgttttggtttta |
36684583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #210
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 160 - 224
Target Start/End: Original strand, 38742184 - 38742248
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaa |
224 |
Q |
| |
|
||||||||| ||||||||||||||||||| | |||| |||||| ||||| |||||| |||||| |
|
|
| T |
38742184 |
taaaatatgtttttagtccctgcaaatatagcgagtttgggttttggtccccggtaaaaaaaaaa |
38742248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 75; Significance: 2e-34; HSPs: 270)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 148 - 238
Target Start/End: Original strand, 34238589 - 34238679
Alignment:
| Q |
148 |
ttttaaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
34238589 |
ttttaattaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttggtaaaaaaaaaattgtttttggtccc |
34238679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 74; E-Value: 9e-34
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 28427608 - 28427527
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
28427608 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccc |
28427527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 74; E-Value: 9e-34
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 37506867 - 37506948
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
37506867 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccc |
37506948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 74; E-Value: 9e-34
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 39436718 - 39436799
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
39436718 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaaaaaaaatttgtttttggtccc |
39436799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 71; E-Value: 6e-32
Query Start/End: Original strand, 156 - 238
Target Start/End: Original strand, 10976977 - 10977059
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
10976977 |
tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaattgtttctggtccc |
10977059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 71; E-Value: 6e-32
Query Start/End: Original strand, 157 - 235
Target Start/End: Original strand, 39288573 - 39288651
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggt |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
39288573 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtctctggtaaaaaaaaaattgtttttggt |
39288651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 3151750 - 3151831
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
3151750 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctagtaaaaaaaaaattgtttttggtccc |
3151831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 3152111 - 3152030
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
3152111 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaatttgtttttggtccc |
3152030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 51834942 - 51834861
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
51834942 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccc |
51834861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 157 - 236
Target Start/End: Complemental strand, 28942905 - 28942826
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtc |
236 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
28942905 |
ggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtc |
28942826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 22155929 - 22156011
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaa-ttgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
22155929 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctggtaaaaaaaaaatttgtttttggtccc |
22156011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 39437109 - 39437027
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaa-ttgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
39437109 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaatttgtttttggtccc |
39437027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 20611020 - 20611101
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
20611020 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtctctggtaaaaaaaaaattgtttttggtccc |
20611101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 158 - 238
Target Start/End: Complemental strand, 22156292 - 22156211
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaa-ttgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
22156292 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaatttgtttttggtccc |
22156211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 30130158 - 30130238
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||| |||||||||||||||||||| |
|
|
| T |
30130158 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcct-gtaaaaaaaaaattgtttttggtccc |
30130238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 31869956 - 31869876
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
31869956 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtccct-gtaaaaaaaaaattgtttttggtccc |
31869876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 37507222 - 37507142
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
37507222 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgataaa-aaaaaattgtttttggtccc |
37507142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 51834608 - 51834689
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
51834608 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaattttgtttttggtccc |
51834689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 155 - 238
Target Start/End: Original strand, 8510212 - 8510296
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaa-ttgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
8510212 |
ttggctaaaatatggttttagtccctgcaaatatgcctctttttggttttagtccctggtaaaaaaaaaatttgtttttggtccc |
8510296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 157 - 237
Target Start/End: Complemental strand, 20612898 - 20612819
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtcc |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
20612898 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaa-aaaaatttgtttttggtcc |
20612819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 156 - 236
Target Start/End: Complemental strand, 25710871 - 25710791
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtc |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
25710871 |
tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaaattgtttttggtc |
25710791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 152 - 235
Target Start/End: Original strand, 28427240 - 28427324
Alignment:
| Q |
152 |
aaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaa-ttgtttttggt |
235 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
28427240 |
aaataggctaaaatatggttttagttcctgcaaatatgtctcgttttggttttagtccctggtaaaaaaaaaatttgtttttggt |
28427324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 155 - 238
Target Start/End: Complemental strand, 40169656 - 40169572
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaa-attgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
40169656 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctggtaaaaaaaaattttgtttttggtccc |
40169572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 144 - 238
Target Start/End: Original strand, 26799875 - 26799970
Alignment:
| Q |
144 |
catattttaaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt-aaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
26799875 |
catatttttaaaaggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggtaaaaaaaaaaattgtttttggtccc |
26799970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 13584367 - 13584285
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaa-ttgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
13584367 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctggtaaaaaaaaaatttgtttttggtccc |
13584285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 40169344 - 40169426
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaa-ttgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
40169344 |
ggctaaaatatggttttaatccctgcaaatatgtctcgttttgattttagtccctggtaaaaaaaaaatttgtttttggtccc |
40169426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 4513263 - 4513342
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
4513263 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct-gtaaa-aaaaaattgtttttggtccc |
4513342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 4513620 - 4513540
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||| ||| |||||||||||||||| |
|
|
| T |
4513620 |
ggctaaaatatggttttactccctgcaaatatgtctcgttttggttttagtccct-gtaaaaaaacaattgtttttggtccc |
4513540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 163 - 239
Target Start/End: Complemental strand, 8510523 - 8510446
Alignment:
| Q |
163 |
aatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaa-ttgtttttggtccca |
239 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
8510523 |
aatatggttttagtccctgcaaatatgtttcgttttggttttagtccctggtaaaaaaaaaatttgtttttggtccca |
8510446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 39288898 - 39288818
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
39288898 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctggtaaa-aaaaaattgattttggtccc |
39288818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 157 - 237
Target Start/End: Original strand, 4950037 - 4950116
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtcc |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| ||||| ||||||||||||| |
|
|
| T |
4950037 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct-gtaaaaaaaaatttgtttttggtcc |
4950116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 14633889 - 14633806
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt--aaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
14633889 |
ggctaaattatggttttagtccctgcaaatatgtcttgttttggttttagtccctggttaaaaaaaaaaattgtttttggtccc |
14633806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 152 - 235
Target Start/End: Complemental strand, 49670808 - 49670725
Alignment:
| Q |
152 |
aaattggctaaaatatggttttagtccc-tgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggt |
235 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
49670808 |
aaattggctaaaatatggttttagtcccctgcaaatatgcttcgttttggttttagtccctggtaaa-aaaaaattgtttttggt |
49670725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 157 - 239
Target Start/End: Complemental strand, 40979710 - 40979629
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccca |
239 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||| ||||| ||||| ||||||||||||||||||||| |
|
|
| T |
40979710 |
ggctaaaatatggttttaatccctgcaaatatggctcgttttggttttaatccct-gtaaaaaaaaaattgtttttggtccca |
40979629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 160 - 238
Target Start/End: Original strand, 45161116 - 45161193
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||| || ||||| |||||||||||||||||||| |
|
|
| T |
45161116 |
taaaatatggtttaagtccctgcaaatatgtctcgttttggttttagtctct-gtaaaaaaaaaattgtttttggtccc |
45161193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 158 - 238
Target Start/End: Complemental strand, 3361817 - 3361736
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt-aaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || ||||||||||||||| ||||| ||| |||||||||||||||||||| |
|
|
| T |
3361817 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtctctggtaaaaaaaaaaattgtttttggtccc |
3361736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 154 - 238
Target Start/End: Original strand, 15016385 - 15016467
Alignment:
| Q |
154 |
attggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| || ||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
15016385 |
attggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctgtgaa--aaaaaattgtttttggtccc |
15016467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 51500685 - 51500605
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| ||||||||||||||||||||| | ||| |||||||||||||||||||| |
|
|
| T |
51500685 |
ggctaaaatatggttctagtccctgcaaatatgcctcgttttggttttagtccct-gcaaaaaaaaaattgtttttggtccc |
51500605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 157 - 237
Target Start/End: Complemental strand, 9863404 - 9863324
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtcc |
237 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||||||||||||||||||||| ||| ||||||| ||||||||||| |
|
|
| T |
9863404 |
ggctaaaatatggttttagtctctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaaatagtttttggtcc |
9863324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 159 - 238
Target Start/End: Original strand, 14633547 - 14633627
Alignment:
| Q |
159 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaa-attgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||| ||||| |||||||||||||| |
|
|
| T |
14633547 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaggccctggtaaaaaaaaattttgtttttggtccc |
14633627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 22008526 - 22008581
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22008526 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
22008581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 22016044 - 22016099
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22016044 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
22016099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 157 - 236
Target Start/End: Original strand, 30424628 - 30424706
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtc |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||| ||||||||| || ||||| |||||||||||||||||| |
|
|
| T |
30424628 |
ggctaaaatatggttttagtccctgcaaatatgtcttgttttagttttagtctct-gtaaaaaaaaaattgtttttggtc |
30424706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 159 - 238
Target Start/End: Original strand, 50196301 - 50196378
Alignment:
| Q |
159 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| |||||| ||||||||||||| |
|
|
| T |
50196301 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct-gtaaa-aaaaaaatgtttttggtccc |
50196378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 53701663 - 53701608
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53701663 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
53701608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 10977341 - 10977259
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataa-aaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||| |||| |||||||||||||| ||||||||||||||||||||||||||| || ||| |||||||||||||| |
|
|
| T |
10977341 |
ggctaaaatatggatttaatccctgcaaatatgcctcgttttggttttagtccctggtaaaaaagaaatttgtttttggtccc |
10977259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 160 - 238
Target Start/End: Original strand, 20757403 - 20757480
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||||||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
20757403 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccct-ataaaaaaaaaattgtttttggtccc |
20757480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 29525105 - 29525183
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
29525105 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtcc--tgtaaa-aaaaaattgtttttggtccc |
29525183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 156 - 238
Target Start/End: Complemental strand, 39072214 - 39072133
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||||||| ||||| ||||| ||||| |||||||||||||||||||| |
|
|
| T |
39072214 |
tggctaaaatatggttttagttcctgcaaatatgcctcgttttgattttaatccct-gtaaaaaaaaaattgtttttggtccc |
39072133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 51759819 - 51759901
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg-gtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
51759819 |
ggctaaaatatggttctagttcctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaaaaattgtttttggtccc |
51759901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 157 - 237
Target Start/End: Original strand, 3830134 - 3830211
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtcc |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
3830134 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccct-gtaa--aaaaaattgtttttggtcc |
3830211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 157 - 237
Target Start/End: Complemental strand, 3830516 - 3830435
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg-gtaaataaaaaattgtttttggtcc |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||| || ||| ||||||||||||||||||| |
|
|
| T |
3830516 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgtaaaaaaaaaaaattgtttttggtcc |
3830435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 4814898 - 4814820
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
4814898 |
ggctaaaatatggttttagtcc-tgcaaatatgtctcgttttggttttagtccct-ataaa-aaaaaattgtttttggtccc |
4814820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 5345689 - 5345608
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||| ||||| ||||||||| |||| |
|
|
| T |
5345689 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgtaaaaaaaaaatttgtttttgatccc |
5345608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 19656541 - 19656622
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||||||||| ||||||||| || ||| |||||||||||||||||||| |
|
|
| T |
19656541 |
ggctaaaatatggttttagtccatgcaaatatgcctcgttttgattttagtccttgtaaaaaaaaaaattgtttttggtccc |
19656622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 156 - 229
Target Start/End: Complemental strand, 26090079 - 26090008
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtt |
229 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
26090079 |
tggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct-gtaaa-aaaaaattgtt |
26090008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 28942525 - 28942606
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || |||||||||||||| ||||||| ||||| |||||||||||||| |
|
|
| T |
28942525 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtttttggtaaaaaaaaatttgtttttggtccc |
28942606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 29446206 - 29446127
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||| ||| ||||| |||||||||||| ||||||| |
|
|
| T |
29446206 |
ggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagt-ccttgtaaa-aaaaaattgtttctggtccc |
29446127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 45320979 - 45320899
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||||||||||||||| ||||| ||||| ||||||||| |||| |
|
|
| T |
45320979 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccct-gtaaaaaaaaatttgtttttgatccc |
45320899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 156 - 212
Target Start/End: Original strand, 4034716 - 4034772
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4034716 |
tggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
4034772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 157 - 229
Target Start/End: Complemental strand, 12741271 - 12741201
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtt |
229 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
12741271 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct-gtaaa-aaaaaattgtt |
12741201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 157 - 237
Target Start/End: Original strand, 43440495 - 43440573
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtcc |
237 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||| |||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
43440495 |
ggctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtccct-ataaa-aaaaaattgtttttggtcc |
43440573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 157 - 237
Target Start/End: Original strand, 46751271 - 46751350
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtcc |
237 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||| ||| ||||| ||||| ||||||||||||| |
|
|
| T |
46751271 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagt-ccttgtaaaaaaaaatttgtttttggtcc |
46751350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 157 - 229
Target Start/End: Complemental strand, 47336581 - 47336511
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtt |
229 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
47336581 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct-gtaaa-aaaaaattgtt |
47336511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 157 - 229
Target Start/End: Complemental strand, 54608863 - 54608793
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtt |
229 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
54608863 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct-gtaaa-aaaaaattgtt |
54608793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 474044 - 474099
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
474044 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
474099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 12740907 - 12740962
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12740907 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
12740962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 156 - 238
Target Start/End: Original strand, 29445953 - 29446036
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggta-aataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |||||||||||||||||||||| | || ||||| |||||||||||||| |
|
|
| T |
29445953 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaacaaaaaaaatttgtttttggtccc |
29446036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 159 - 238
Target Start/End: Original strand, 31869596 - 31869675
Alignment:
| Q |
159 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||||||||||||||||| ||| ||||| ||| |||||||||| |
|
|
| T |
31869596 |
ctaaaatatggttttaattcctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaaatttgattttggtccc |
31869675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 151 - 238
Target Start/End: Complemental strand, 50196663 - 50196576
Alignment:
| Q |
151 |
taaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||| |||||||||||||||||||||||| |||||||| |||||||| ||||||||||||| ||| |||||| |||||||| |||| |
|
|
| T |
50196663 |
taaataggctaaaatatggttttagtccctacaaatatgcctcgtttttgttttagtccctgtaaaaaaaaaaaatgtttttgatccc |
50196576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 51550446 - 51550391
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51550446 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
51550391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 275444 - 275523
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| ||||||||| |||||||||||| || |||||||||||||||||||| |
|
|
| T |
275444 |
ggctaaaatatggttttagtccctgcaactatgcctcgttttgattttagtccctg--caaaaaaaaattgtttttggtccc |
275523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 155 - 238
Target Start/End: Original strand, 16123137 - 16123222
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg--gtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||| ||| ||||||||||||||| |||| |
|
|
| T |
16123137 |
ttggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctgtacaaaaaaaaaaattgtttttgatccc |
16123222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 18175791 - 18175868
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||| ||||| ||||| |||||||||||||||||||| |
|
|
| T |
18175791 |
ggctaaaatatggttttagtccctgcaaatatgtctcg--ttggttttaatccct-gtaaa-aaaaaattgtttttggtccc |
18175868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 160 - 238
Target Start/End: Complemental strand, 20907454 - 20907376
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||| |||||||||||||| ||| ||| |||||||||||||||||||| |
|
|
| T |
20907454 |
taaaatatggttttaatccctgcaaatatgcctcattttggttttagtctctgtgaaaaaaaaaattgtttttggtccc |
20907376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 160 - 238
Target Start/End: Original strand, 49670477 - 49670554
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||| ||||||||| |||||||||| || |||||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
49670477 |
taaaatatgattttagtccttgcaaatatggcttgttttggttttaatccctggtaaa-aaaaaattgtttttggtccc |
49670554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 4814540 - 4814620
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| || | ||||| |||| |||||||||||||| |
|
|
| T |
4814540 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttattctgt-gtaaaaaaaagtttgtttttggtccc |
4814620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 15979701 - 15979620
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||||||||||||||||||||||||| ||| ||| |||||||||||||| |
|
|
| T |
15979701 |
ggctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtccctgtaaaaaaaattgttgtttttggtccc |
15979620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 22008892 - 22008835
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
22008892 |
ttggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
22008835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 157 - 226
Target Start/End: Original strand, 25710510 - 25710578
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaatt |
226 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||| ||||||||||| ||||| |||||||| |
|
|
| T |
25710510 |
ggctcaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccct-gtaaaaaaaaaatt |
25710578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 43441268 - 43441325
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43441268 |
ttggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg |
43441325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 157 - 237
Target Start/End: Complemental strand, 46186771 - 46186690
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaa-ttgtttttggtcc |
237 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |||||||||||||||||| ||| ||| |||||| ||||||||||||| |
|
|
| T |
46186771 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtctctgtaaaaaaaaaaatttgtttttggtcc |
46186690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 156 - 229
Target Start/End: Original strand, 49323781 - 49323852
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtt |
229 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
49323781 |
tggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccct-gtaaa-aaaaaattgtt |
49323852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 21159453 - 21159505
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
21159453 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtcc |
21159505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 21159817 - 21159735
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaa--ttgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||| ||| ||||| | |||| |||||||||||||| |
|
|
| T |
21159817 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcct-gtaaaaagaaaattttgtttttggtccc |
21159735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 157 - 229
Target Start/End: Original strand, 31480136 - 31480206
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtt |
229 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
31480136 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccct-gtaaa-aaaaaattgtt |
31480206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 160 - 212
Target Start/End: Complemental strand, 35569133 - 35569081
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35569133 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35569081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 474408 - 474353
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
474408 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg |
474353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 159 - 238
Target Start/End: Complemental strand, 7518444 - 7518366
Alignment:
| Q |
159 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||| || ||||| |||||| |||||||| |||| |
|
|
| T |
7518444 |
ctaaaatatggttttactccctgcaaatatgtctcgttttggttttagt-tcttgtaaaaaaaaaaatgtttttgatccc |
7518366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 25615975 - 25616030
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
25615975 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
25616030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 28552383 - 28552328
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
28552383 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
28552328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #92
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 208
Target Start/End: Complemental strand, 29490743 - 29490692
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
29490743 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
29490692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #93
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 30268505 - 30268560
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
30268505 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
30268560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #94
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 30552478 - 30552423
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
30552478 |
ggctaaaatatcgttttagtccatgcaaatatgtctcgttttggttttagtccctg |
30552423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #95
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 224
Target Start/End: Complemental strand, 34238915 - 34238848
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaa |
224 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |||||||||||||||||| ||||||| |||||| |
|
|
| T |
34238915 |
ggctaaaatatggttttagtccccgcaaatatgcttcgttttggttttagtccttggtaaaaaaaaaa |
34238848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #96
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 154 - 229
Target Start/End: Original strand, 44802279 - 44802352
Alignment:
| Q |
154 |
attggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtt |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||| ||| ||||| ||||||||||| |
|
|
| T |
44802279 |
attggctaaaatatggttttagtccctgcaaatatgcgtcgttttggttttagttcct-gtaaa-aaaaaattgtt |
44802352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #97
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 47005154 - 47005209
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
47005154 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttagttttagtccctg |
47005209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #98
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 51550082 - 51550137
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
51550082 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
51550137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #99
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 54608518 - 54608573
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
54608518 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
54608573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #100
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 9261786 - 9261844
Alignment:
| Q |
154 |
attggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
9261786 |
attggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
9261844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #101
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 160 - 238
Target Start/End: Original strand, 9863050 - 9863126
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||| |||||| ||||||||||||||||||||| |||| ||||||||||||||| |||| |
|
|
| T |
9863050 |
taaaatatggttttagtccctgc-aatatgcctcgttttggttttagtccct-ataaaaaaaaaattgtttttgatccc |
9863126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #102
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 12673644 - 12673726
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg-gtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||| |||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
12673644 |
ggctaaaatatagttttagtccctgtaaatatgcctcgttttggttttagtccctgtaaaaataaaattttgtttttggtccc |
12673726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #103
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 159 - 238
Target Start/End: Original strand, 29955300 - 29955380
Alignment:
| Q |
159 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaa--attgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||| ||||||||||| ||||| ||||| |||||||||||||| |
|
|
| T |
29955300 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccct-gtaaaaaaaaacttttgtttttggtccc |
29955380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #104
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 159 - 238
Target Start/End: Original strand, 30004454 - 30004534
Alignment:
| Q |
159 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaa--attgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||| ||||||||||| ||||| ||||| |||||||||||||| |
|
|
| T |
30004454 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccct-gtaaaaaaaaacttttgtttttggtccc |
30004534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #105
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 157 - 210
Target Start/End: Complemental strand, 9262155 - 9262102
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccc |
210 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
9262155 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
9262102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #106
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 26089728 - 26089785
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
26089728 |
ttggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
26089785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #107
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 157 - 226
Target Start/End: Complemental strand, 29955666 - 29955598
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaatt |
226 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| ||||||||||||||||| ||| ||||| |||||||| |
|
|
| T |
29955666 |
ggcttaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcct-gtaaaaaaaaaatt |
29955598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #108
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 157 - 226
Target Start/End: Complemental strand, 30004821 - 30004753
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaatt |
226 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| ||||||||||||||||| ||| ||||| |||||||| |
|
|
| T |
30004821 |
ggcttaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcct-gtaaaaaaaaaatt |
30004753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #109
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 30128284 - 30128364
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||||||||||||||||||| ||| ||||| ||| |||||||||||||| |
|
|
| T |
30128284 |
ggctaaaatatggttttggtccctgcaaacatgtctcgttttggttttagttcct-gtaaaaaaattgttgtttttggtccc |
30128364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #110
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 31480502 - 31480445
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
31480502 |
ttggctaaaatatggatttggtccctgcaaatatgcctcgttttggttttagtccctg |
31480445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #111
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 157 - 210
Target Start/End: Complemental strand, 40370589 - 40370536
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccc |
210 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
40370589 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
40370536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #112
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 147 - 212
Target Start/End: Original strand, 45002011 - 45002076
Alignment:
| Q |
147 |
attttaaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||| ||| ||||||||||||||||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
45002011 |
atttttaataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttcctg |
45002076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #113
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 157 - 234
Target Start/End: Original strand, 46901104 - 46901179
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttgg |
234 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |||||||||||||||| || ||||| |||||||||||||||| |
|
|
| T |
46901104 |
ggctaaaatatggttttagtctctgcaaatatgtatcgttttggttttagtttct-gtaaa-aaaaaattgtttttgg |
46901179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #114
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 160 - 212
Target Start/End: Original strand, 3387268 - 3387320
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3387268 |
taaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
3387320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #115
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 160 - 212
Target Start/End: Complemental strand, 8940522 - 8940470
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
8940522 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
8940470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #116
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 156 - 212
Target Start/End: Original strand, 15979337 - 15979393
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
15979337 |
tggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
15979393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #117
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 145 - 229
Target Start/End: Original strand, 19844253 - 19844336
Alignment:
| Q |
145 |
atattttaaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtt |
229 |
Q |
| |
|
|||||| || ||||||||||||||||||| |||||| |||||||| |||||||| ||||||||||| ||||| ||||||||||| |
|
|
| T |
19844253 |
atatttcaagttggctaaaatatggttttggtccctacaaatatgcctcgttttaattttagtccct-gtaaaaaaaaaattgtt |
19844336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #118
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 157 - 229
Target Start/End: Complemental strand, 19844581 - 19844511
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtt |
229 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| ||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
19844581 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccct-gtaaa-aaaaaattgtt |
19844511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #119
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 157 - 237
Target Start/End: Complemental strand, 30130504 - 30130425
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtcc |
237 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||| ||| ||||||||||||||| | || || ||||||||||||||||||| |
|
|
| T |
30130504 |
ggctcaaatatggttttagtcactgcaaatatgcctcattttggttttagtccat-gtgaaaaaaaaattgtttttggtcc |
30130425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #120
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 157 - 229
Target Start/End: Complemental strand, 45002385 - 45002315
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtt |
229 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||| ||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
45002385 |
ggctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtccct-gtaaa-aaaaaattgtt |
45002315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #121
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 158 - 237
Target Start/End: Original strand, 46186410 - 46186490
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg-gtaaataaaaaattgtttttggtcc |
237 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||||||| ||||||||| || ||| ||||||||||||||||||| |
|
|
| T |
46186410 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagtccttgtaaaaaaaaaaaattgtttttggtcc |
46186490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #122
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 155 - 238
Target Start/End: Complemental strand, 47902147 - 47902066
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||| ||||||||||| ||||||||| | ||||||||||||||||||| ||| |||||| ||||||||||||| |
|
|
| T |
47902147 |
ttggctaaaatatagttttagtccccgcaaatatgcattgttttggttttagtccctgttaa--aaaaaaatgtttttggtccc |
47902066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #123
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 160 - 212
Target Start/End: Complemental strand, 49324143 - 49324091
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
49324143 |
taaaatatggttttggtccctgtaaatatgtctcgttttggttttagtccctg |
49324091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #124
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 157 - 229
Target Start/End: Complemental strand, 52342583 - 52342512
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtt |
229 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||| ||||||||||||||||||| | ||||| ||||||||||| |
|
|
| T |
52342583 |
ggctaaaatatggtttttgtctctgcaaatatgcctcgttttggttttagtccat-gtaaaaaaaaaattgtt |
52342512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #125
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 1721452 - 1721397
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
1721452 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
1721397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #126
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 153 - 212
Target Start/End: Complemental strand, 4035057 - 4034998
Alignment:
| Q |
153 |
aattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |||||||| |||||||| |||| |
|
|
| T |
4035057 |
aattggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagttcctg |
4034998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #127
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 28552021 - 28552076
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
28552021 |
ggctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtccctg |
28552076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #128
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 30034472 - 30034417
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
30034472 |
ggctaaaatatggttttgctccttgcaaatatgtctcgttttggttttagtccctg |
30034417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #129
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 30106220 - 30106165
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
30106220 |
ggctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtccctg |
30106165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #130
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 32119220 - 32119275
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
32119220 |
ggctaaaatatagttttggtccctgcaaatatgtctcgttttagttttagtccctg |
32119275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #131
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 32119584 - 32119529
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
32119584 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
32119529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #132
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 40545564 - 40545619
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
40545564 |
ggctaaaatatggttttggtccctgcaaatatgactcgttttagttttagtccctg |
40545619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #133
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 43441603 - 43441548
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
43441603 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctg |
43441548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #134
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 46622129 - 46622074
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
46622129 |
ggctaaaatatggttttggtccttgcaaatatgtttcgttttggttttagtccctg |
46622074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #135
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 208
Target Start/End: Original strand, 47114487 - 47114538
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
47114487 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtc |
47114538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #136
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 47336228 - 47336283
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
47336228 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
47336283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #137
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 48924240 - 48924185
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
48924240 |
ggctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtccctg |
48924185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #138
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 155 - 238
Target Start/End: Original strand, 53701359 - 53701440
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||| || |||| |||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
53701359 |
ttggctaaaatatggttttaatctctgcaaatatgccttattttagttttagtccct-gtaaa-aaaaaattgtttttggtccc |
53701440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #139
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 146 - 212
Target Start/End: Complemental strand, 7957237 - 7957171
Alignment:
| Q |
146 |
tattttaaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||| || |||||||||||||| |||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
7957237 |
tatttaaatttggctaaaatatgattttggtccctgcaaatatgcgtcgttttggttttagtccctg |
7957171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #140
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 157 - 211
Target Start/End: Original strand, 9603629 - 9603683
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccct |
211 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
9603629 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccct |
9603683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #141
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 158 - 212
Target Start/End: Original strand, 11463233 - 11463287
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||| || |||||||||||| |||||||||||||||||||||| |
|
|
| T |
11463233 |
gctaaaatatggttttggttcctgcaaatatgcctcgttttggttttagtccctg |
11463287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #142
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 157 - 207
Target Start/End: Original strand, 35177255 - 35177305
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
207 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
35177255 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagt |
35177305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #143
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 159 - 229
Target Start/End: Complemental strand, 45006247 - 45006179
Alignment:
| Q |
159 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtt |
229 |
Q |
| |
|
||||||||| ||||||||||||||||||||| ||||||||||||||| ||||| ||||| ||||||||||| |
|
|
| T |
45006247 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttaatccct-gtaaa-aaaaaattgtt |
45006179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #144
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 7518090 - 7518171
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |||||||| |||||||||| || ||| ||| |||||||||||||| |
|
|
| T |
7518090 |
ggctaaaatatggtgttagtccctgcaaatatgcctcgtttttgttttagtccttgtaaaaaaaagttttgtttttggtccc |
7518171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #145
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 157 - 210
Target Start/End: Original strand, 14772211 - 14772264
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccc |
210 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
14772211 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccc |
14772264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #146
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 159 - 236
Target Start/End: Complemental strand, 14772523 - 14772447
Alignment:
| Q |
159 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtc |
236 |
Q |
| |
|
|||||||||||||||||| | ||||||||| ||| ||||||||||||||||| ||||| ||||| |||||||||||| |
|
|
| T |
14772523 |
ctaaaatatggttttagtacatgcaaatatacctcattttggttttagtccct-gtaaaaaaaaagttgtttttggtc |
14772447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #147
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 20644503 - 20644560
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
20644503 |
ttggctaaaatatagttttggtccctgcaaatatgtctcattttgattttagtccctg |
20644560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #148
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 151 - 212
Target Start/End: Complemental strand, 35407796 - 35407735
Alignment:
| Q |
151 |
taaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
35407796 |
taaataggctaaaatatggttttgatccctgcaaatatgtcttgtttttgttttagtccctg |
35407735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #149
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 157 - 226
Target Start/End: Original strand, 38232241 - 38232309
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaatt |
226 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||| ||||||| ||| ||||| |||||||| |
|
|
| T |
38232241 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttgattttagt-ccttgtaaaaaaaaaatt |
38232309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #150
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 145 - 226
Target Start/End: Complemental strand, 39820675 - 39820594
Alignment:
| Q |
145 |
atattttaaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaatt |
226 |
Q |
| |
|
|||||| |||| ||||||||||||||||| |||||||||||||| | |||| |||||| |||||||||||| |||||||| |
|
|
| T |
39820675 |
atatttaaaataggctaaaatatggttttggtccctgcaaatatagcgagtttgggttttggtccctggtaaaaaaaaaatt |
39820594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #151
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 156 - 229
Target Start/End: Original strand, 40370284 - 40370355
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtt |
229 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||||||||||| |||||||| ||| ||||| ||||||||||| |
|
|
| T |
40370284 |
tggctaaaatatgattttggtccctgcaaatatgtctcgttttagttttagttcct-gtaaa-aaaaaattgtt |
40370355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #152
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 45005884 - 45005941
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||||||||||| |||||||||||| |
|
|
| T |
45005884 |
ttggttaaaatatggttttgatccctgcaaatatgtctcgttttgattttagtccctg |
45005941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #153
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 160 - 212
Target Start/End: Complemental strand, 863649 - 863597
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||| |||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
863649 |
taaaatatggttttggtccctgcaaatatgtttcgttttgattttagtccctg |
863597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #154
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 160 - 212
Target Start/End: Original strand, 1721092 - 1721144
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
1721092 |
taaaatatggttttggtccttgcaaatatgtctcattttggttttagtccctg |
1721144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #155
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 3387604 - 3387552
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
3387604 |
ggctaaaatatggttttggtcgctgcaaatatgcctcgttttggttttagtcc |
3387552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #156
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 160 - 212
Target Start/End: Complemental strand, 4322186 - 4322134
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
4322186 |
taaaatatagttttggtccctgcaaatatgtcttgttttggttttagtccctg |
4322134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #157
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 182 - 238
Target Start/End: Complemental strand, 10778706 - 10778651
Alignment:
| Q |
182 |
caaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
10778706 |
caaatatgcctcgttttggttttagtccctggtaaa-aaaaaattgttattggtccc |
10778651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #158
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 13514577 - 13514525
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
|||||||||||| |||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
13514577 |
ggctaaaatatgattttggtacctgcaaatatgtctcgttttggttttagtcc |
13514525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #159
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 157 - 229
Target Start/End: Original strand, 21553889 - 21553960
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtt |
229 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||| ||||||| |||| ||||| ||||| ||||| |
|
|
| T |
21553889 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagcccct-gtaaaaaaaaatttgtt |
21553960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #160
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 28452147 - 28452199
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||| |||||||||||||||| |
|
|
| T |
28452147 |
ggctaaaatatggttttggtccttgcaaatatgtcttgttttggttttagtcc |
28452199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #161
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 160 - 212
Target Start/End: Complemental strand, 40545836 - 40545784
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
40545836 |
taaaatatgattttggtccctgcaaatatgtctcattttggttttagtccctg |
40545784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #162
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 159 - 238
Target Start/End: Complemental strand, 43440785 - 43440708
Alignment:
| Q |
159 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||||||||||||||||| | || |||||||||||||||||||| |
|
|
| T |
43440785 |
ctaaaatataattttagtccctgcaaatatgcctcgttttggttttagtccat--ataagaaaaaattgtttttggtccc |
43440708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #163
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 156 - 212
Target Start/End: Complemental strand, 45313864 - 45313808
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
45313864 |
tggctaaaatatggttttggtccctgcaaatatgcttcgttttgattttagtccctg |
45313808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #164
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 47005519 - 47005467
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
47005519 |
ggctaaaatatggttttggtccctgcaaatattcctcgttttggttttagtcc |
47005467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #165
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 156 - 208
Target Start/End: Complemental strand, 50261937 - 50261885
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
50261937 |
tggctaaaatatcgttttagtccctgcaaatatgtttcattttggttttagtc |
50261885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #166
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 158 - 206
Target Start/End: Complemental strand, 51760117 - 51760069
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttag |
206 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
51760117 |
gctaaaatatggttctagtccctgcaaatatgcctcgttttggttttag |
51760069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #167
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 9597095 - 9597040
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
9597095 |
ggctaaaatatggttttgttccctgcaaatatgcttcgttttggttttagtccctg |
9597040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #168
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 157 - 208
Target Start/End: Original strand, 15286156 - 15286207
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
15286156 |
ggctaaaatatggttttaatccctgcaaatatgcttcgttttggttttagtc |
15286207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #169
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 167 - 238
Target Start/End: Complemental strand, 16123491 - 16123422
Alignment:
| Q |
167 |
tggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||||| || ||||| |||||||||||||||||||| |
|
|
| T |
16123491 |
tggttttagtcc-tgcaaatatgcctcgttttggttttagt-tcttgtaaaaaaaaaattgtttttggtccc |
16123422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #170
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 158 - 209
Target Start/End: Complemental strand, 25610129 - 25610078
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
25610129 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtcc |
25610078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #171
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 28452376 - 28452321
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| |||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
28452376 |
ggctaaaatatggttttggtccctacaaatatgcttcgttttggttttagtccctg |
28452321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #172
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 29686544 - 29686599
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||| ||||||||||| |||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
29686544 |
ggctagaatatggttttggtccatgcaaatatgtcttgttttggttttagtccctg |
29686599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #173
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 160 - 238
Target Start/End: Original strand, 30552150 - 30552225
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||| || ||||||||||||| |||||||||||||||||| ||| ||||||||||||||| |||| |
|
|
| T |
30552150 |
taaaatatggttttagacc-tgcaaatatgtcttgttttggttttagtccct--caaaaaaaaaattgtttttgatccc |
30552225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #174
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 35565508 - 35565563
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
35565508 |
ggctaaaatatggttttgttccctgcaaatatacctcgttttggttttagtccctg |
35565563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #175
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 157 - 204
Target Start/End: Original strand, 53113443 - 53113490
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttt |
204 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
53113443 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttgttttt |
53113490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #176
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 156 - 238
Target Start/End: Complemental strand, 275834 - 275754
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||| |||||||||||||||| || ||||| |||||| ||||||||||||| |
|
|
| T |
275834 |
tggctaaaatatgattttagtccctgtaaatatgcttcgttttggttttagttcc-agtaaa-aaaaaaatgtttttggtccc |
275754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #177
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 158 - 212
Target Start/End: Original strand, 9596759 - 9596813
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
9596759 |
gctaaaatatggtttttgtctctgcaaatatgcatcgttttggttttagtccctg |
9596813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #178
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 160 - 238
Target Start/End: Original strand, 27200441 - 27200519
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||| ||||||||||||| |||| |||| |||||||| | || |||| |||| |||||||||||||| |
|
|
| T |
27200441 |
taaaatatggttttaatccctgcaaatatatctcattttagttttagttcttgataaaataaaatttgtttttggtccc |
27200519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #179
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 158 - 212
Target Start/End: Complemental strand, 28418899 - 28418845
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| | |||||| |||||||||||| |
|
|
| T |
28418899 |
gctaaaatatggttttggtccctgcaaatatgttttgttttgattttagtccctg |
28418845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #180
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 156 - 210
Target Start/End: Complemental strand, 30426227 - 30426174
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccc |
210 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||||| |||||||||| |
|
|
| T |
30426227 |
tggctaaaatatggttttagtcc-tgcaaatatgcctcgttttgattttagtccc |
30426174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #181
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 160 - 226
Target Start/End: Complemental strand, 45521833 - 45521768
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaatt |
226 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||||||||||||| ||| ||||| |||||||| |
|
|
| T |
45521833 |
taaaatatggttttagtctttgcaaatatgtttcgttttggttttagttcct-gtaaaaaaaaaatt |
45521768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #182
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 167 - 212
Target Start/End: Complemental strand, 25610061 - 25610016
Alignment:
| Q |
167 |
tggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
25610061 |
tggttttggtccctgcaaatatgtctcgttttggttttggtccctg |
25610016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #183
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 157 - 229
Target Start/End: Original strand, 863281 - 863351
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtt |
229 |
Q |
| |
|
|||||||||||| |||| |||| ||||||||||||||||||| ||||||||| || ||||| ||||||||||| |
|
|
| T |
863281 |
ggctaaaatatgattttggtccatgcaaatatgtctcgttttagttttagtctct-gtaaa-aaaaaattgtt |
863351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #184
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 159 - 207
Target Start/End: Original strand, 2486581 - 2486629
Alignment:
| Q |
159 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
207 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||| ||||||||||||| |
|
|
| T |
2486581 |
ctaaaatatggtttttgtccctgcaaatatgactcattttggttttagt |
2486629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #185
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 157 - 205
Target Start/End: Complemental strand, 9603919 - 9603871
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
205 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| ||||||||||| |
|
|
| T |
9603919 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggtttta |
9603871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #186
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 160 - 208
Target Start/End: Original strand, 36672966 - 36673014
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||| ||||||||||||||| |
|
|
| T |
36672966 |
taaaatatggttttggtctctgcaaatatgtcttgttttggttttagtc |
36673014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #187
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 148 - 224
Target Start/End: Original strand, 44506573 - 44506649
Alignment:
| Q |
148 |
ttttaaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaa |
224 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||| | ||||||||||| ||| ||| |||| |||||| |
|
|
| T |
44506573 |
ttttaaaaaggctaaaatatggttttagtccctgcaaatataacgagttttggtttttgtctctgataaaaaaaaaa |
44506649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #188
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 157 - 205
Target Start/End: Original strand, 52342195 - 52342243
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
205 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| ||||||||||| |
|
|
| T |
52342195 |
ggctaaaatatggttttggtccctgcaaatatgcctccttttggtttta |
52342243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #189
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 160 - 212
Target Start/End: Complemental strand, 54767524 - 54767472
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||| |||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
54767524 |
taaaatatggttttggtccctagaaatatgtctcgttttgattttagtccctg |
54767472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #190
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 157 - 208
Target Start/End: Original strand, 7588318 - 7588369
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||| || ||||||||||||||| |
|
|
| T |
7588318 |
ggctaaaatatagttttggtccctgcaaatatgccttgttttggttttagtc |
7588369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #191
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 27681682 - 27681627
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||| | ||| ||||||||||| ||||||||||||||| |||||| |
|
|
| T |
27681682 |
ggctaaaatatggttctggtctctgcaaatatgcctcgttttggttttaatccctg |
27681627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #192
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 29678024 - 29678079
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||| ||||| ||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
29678024 |
ggctaaaatatagttttggtctttgcaaatatgcctcgttttggttttagtccctg |
29678079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #193
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 34582524 - 34582579
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||| || ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
34582524 |
ggctaaaatatggcattggtccctgcaaatatgtccagttttggttttagtccctg |
34582579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #194
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 35498416 - 35498471
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||| |||||||||| |||||||| |||||||||||||| |||||| |
|
|
| T |
35498416 |
ggctaaaatatgggtttagtccctacaaatatgattcgttttggttttaatccctg |
35498471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #195
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 159 - 206
Target Start/End: Original strand, 35533281 - 35533328
Alignment:
| Q |
159 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttag |
206 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||| ||||||||||||| |
|
|
| T |
35533281 |
ctaaaatatggttttggtctctgcaaatatgtcttgttttggttttag |
35533328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #196
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 170 - 213
Target Start/End: Complemental strand, 39132834 - 39132791
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
39132834 |
ttttggtccctgcaaatatgtctcgttttggttttggtccctgg |
39132791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #197
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 39132906 - 39132851
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| || | ||||||| |||||||| |
|
|
| T |
39132906 |
ggctaaaatatggttttggtccctgcaaatatgtttcatattggtttaagtccctg |
39132851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #198
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 40277822 - 40277877
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
40277822 |
ggctaaaatgtggttttggtccctgcaaatatgcttcgttttggttttactccctg |
40277877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #199
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 157 - 208
Target Start/End: Original strand, 51500398 - 51500449
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
||||||||||||||| ||||| ||| ||||||| |||||||||||||||||| |
|
|
| T |
51500398 |
ggctaaaatatggttctagtctctgtaaatatgcctcgttttggttttagtc |
51500449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #200
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 159 - 205
Target Start/End: Complemental strand, 2486900 - 2486854
Alignment:
| Q |
159 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
205 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
2486900 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
2486854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #201
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 170 - 212
Target Start/End: Complemental strand, 7957154 - 7957112
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
7957154 |
ttttggtccctgcaaatatgtctcgttttggttttggtccctg |
7957112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #202
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 157 - 199
Target Start/End: Original strand, 25353199 - 25353241
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttg |
199 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
25353199 |
ggctagaatatggttttagtccctgcaaatatgcctcgttttg |
25353241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #203
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 160 - 238
Target Start/End: Original strand, 36732643 - 36732720
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||| |||||| |||||||||||||||||| ||||||||||||| || ||||| |||| |||||||||||||| |
|
|
| T |
36732643 |
taaaataaggttttggtccctgcaaatatgtcttattttggttttagtttct-gtaaaaaaaattttgtttttggtccc |
36732720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #204
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 159 - 238
Target Start/End: Original strand, 46724545 - 46724625
Alignment:
| Q |
159 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaa--attgtttttggtccc |
238 |
Q |
| |
|
|||||||||| |||| ||| ||||||||| ||||||||| |||||||||||| ||||| ||||| ||||||||||||||| |
|
|
| T |
46724545 |
ctaaaatatgattttgatccttgcaaatatatctcgttttagttttagtccct-gtaaaaaaaaattattgtttttggtccc |
46724625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #205
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 160 - 210
Target Start/End: Original strand, 47901803 - 47901853
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccc |
210 |
Q |
| |
|
|||||||||||||||||| ||| ||||||| ||||||||||||||||||| |
|
|
| T |
47901803 |
taaaatatggttttagtctctggaaatatgcatcgttttggttttagtccc |
47901853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #206
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 157 - 223
Target Start/End: Original strand, 53121302 - 53121368
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaa |
223 |
Q |
| |
|
|||||||||||| |||| |||||||||||||| | |||| ||||||||||||||||||| ||||| |
|
|
| T |
53121302 |
ggctaaaatatgtttttggtccctgcaaatatagcgagtttgggttttagtccctggtaaaaaaaaa |
53121368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #207
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 160 - 209
Target Start/End: Complemental strand, 8555305 - 8555256
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
|||||||||||||| |||| |||||||||| |||||||||||||||||| |
|
|
| T |
8555305 |
taaaatatggttttggtccatgcaaatatgcatcgttttggttttagtcc |
8555256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #208
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 16679678 - 16679727
Alignment:
| Q |
159 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||||| |
|
|
| T |
16679678 |
ctaaaatatggttttagtccttgaaaatatgcttcgttttggttttagtc |
16679727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #209
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 158 - 223
Target Start/End: Complemental strand, 20489416 - 20489351
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaa |
223 |
Q |
| |
|
||||||||||| |||| ||||||||||||||| | |||| |||||| |||||||||||| ||||| |
|
|
| T |
20489416 |
gctaaaatatgtttttggtccctgcaaatatgacgagtttgggttttggtccctggtaaaaaaaaa |
20489351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #210
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 176 - 213
Target Start/End: Original strand, 20644584 - 20644621
Alignment:
| Q |
176 |
tccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
20644584 |
tccctgcaaatatgtctcgttttggttttggtccctgg |
20644621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #211
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 25609767 - 25609848
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||| ||| | |||||| | |||||||||||||||||||||| ||| ||| |||||||||||||| |
|
|
| T |
25609767 |
ggctaaaatatggttttggtctttacaaataagcctcgttttggttttagtccctgtaaaaaaaattgttgtttttggtccc |
25609848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #212
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 148 - 189
Target Start/End: Complemental strand, 26800178 - 26800137
Alignment:
| Q |
148 |
ttttaaattggctaaaatatggttttagtccctgcaaatatg |
189 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
26800178 |
ttttaaaaaggctaaaatatggttttagtccctgcaaatatg |
26800137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #213
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 170 - 211
Target Start/End: Complemental strand, 28452303 - 28452262
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccct |
211 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
28452303 |
ttttagtccctgcaaatatgtctcattttggttttggtccct |
28452262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #214
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 158 - 207
Target Start/End: Complemental strand, 36673244 - 36673195
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
207 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| || ||||||||||||| |
|
|
| T |
36673244 |
gctaaaatatggttttggtccctgcaaatatgacttattttggttttagt |
36673195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #215
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 163 - 208
Target Start/End: Complemental strand, 38232594 - 38232549
Alignment:
| Q |
163 |
aatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||||||| |||| |
|
|
| T |
38232594 |
aatatggttttggtacctgcaaatatgtctcgttttggtttcagtc |
38232549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #216
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 147 - 188
Target Start/End: Original strand, 43641133 - 43641174
Alignment:
| Q |
147 |
attttaaattggctaaaatatggttttagtccctgcaaatat |
188 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
43641133 |
atttaaaattggctaaaatatgcttttagtccctgcaaatat |
43641174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #217
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 158 - 211
Target Start/End: Original strand, 50008921 - 50008974
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccct |
211 |
Q |
| |
|
|||| ||||||||||| |||||||||||||||| | ||||||||||||||||| |
|
|
| T |
50008921 |
gctagaatatggttttggtccctgcaaatatgttttattttggttttagtccct |
50008974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #218
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 157 - 218
Target Start/End: Original strand, 52401017 - 52401078
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaat |
218 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| | |||| |||||| ||||||||||||| |
|
|
| T |
52401017 |
ggctaaaatatgtttttggtccctgcaaatatggcgagtttgggttttggtccctggtaaat |
52401078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #219
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 160 - 212
Target Start/End: Original strand, 8940163 - 8940215
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||| || |||||||||| |||||||||||||||||||||| |
|
|
| T |
8940163 |
taaaatatggttttgatctctgcaaatatacctcgttttggttttagtccctg |
8940215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #220
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 160 - 212
Target Start/End: Original strand, 10778373 - 10778425
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||||||| ||||||| |||| |
|
|
| T |
10778373 |
taaaatatggttttagtttctgcaaatatgcctcgttttgattttagttcctg |
10778425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #221
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 160 - 238
Target Start/End: Original strand, 20807800 - 20807874
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||| || ||||| ||||||||| |||| |||||||||||||||||||| |
|
|
| T |
20807800 |
taaaatatggttttagtccctgcaaatatacgtcattttgattttagtcc--tgtaa--aaaaaattgtttttggtccc |
20807874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #222
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 155 - 211
Target Start/End: Complemental strand, 29678389 - 29678333
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccct |
211 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||| | ||||||||||||| |||| |
|
|
| T |
29678389 |
ttggctaaaatatgattttggtccctgcaaatatgccctgttttggttttagcccct |
29678333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #223
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 160 - 208
Target Start/End: Original strand, 40723121 - 40723169
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||| ||||||||||||| |
|
|
| T |
40723121 |
taaaatatggttttagtccttgcaaatattcctcgatttggttttagtc |
40723169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #224
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 157 - 201
Target Start/End: Complemental strand, 44802548 - 44802504
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggt |
201 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
44802548 |
ggctaaaatatgattttgatccctgcaaatatgtctcgttttggt |
44802504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #225
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 155 - 207
Target Start/End: Original strand, 52956381 - 52956433
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
207 |
Q |
| |
|
||||||||||||| |||| |||||| | |||||||||||||||||||||||| |
|
|
| T |
52956381 |
ttggctaaaatatacttttggtccctactaatatgtctcgttttggttttagt |
52956433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #226
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Complemental strand, 474335 - 474292
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
474335 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgg |
474292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #227
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 4321946 - 4322001
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||| | ||| |||||||||||||| ||||||||||| |||||| |
|
|
| T |
4321946 |
ggctaaaatatggttctgatccttgcaaatatgtctcattttggttttaatccctg |
4322001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #228
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 160 - 207
Target Start/End: Complemental strand, 12673978 - 12673931
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
207 |
Q |
| |
|
||||||||| ||||||| |||||||||||| ||| ||||||||||||| |
|
|
| T |
12673978 |
taaaatatgattttagttcctgcaaatatgcctcattttggttttagt |
12673931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #229
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 12740980 - 12741023
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
12740980 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgg |
12741023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #230
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 15979411 - 15979454
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
15979411 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgg |
15979454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #231
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 20405223 - 20405168
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||| | ||||| ||||||||||||| |
|
|
| T |
20405223 |
ggctaaaatatggttttggtccctgcaaatatactttgttttagttttagtccctg |
20405168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #232
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 20644876 - 20644821
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||| |||||| | ||||||| |||||||||||| |
|
|
| T |
20644876 |
ggctaaaatatggttttggtccctgtaaatataccccgttttgattttagtccctg |
20644821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #233
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 157 - 208
Target Start/End: Complemental strand, 20757775 - 20757724
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
|||||||||||| ||||| |||||| ||||||| ||||||||||||||||| |
|
|
| T |
20757775 |
ggctaaaatatgattttaatccctgtaaatatgcatcgttttggttttagtc |
20757724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #234
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 178 - 238
Target Start/End: Original strand, 20907158 - 20907220
Alignment:
| Q |
178 |
cctgcaaatatgtctcgttttggttttagtccctg--gtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||||||| ||||||||| |||| |
|
|
| T |
20907158 |
cctgtaaatatgtctcgttttggttttagtccctgtaaaaaataaaaatttgtttttgatccc |
20907220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #235
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Complemental strand, 22008817 - 22008774
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
22008817 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgg |
22008774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #236
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Complemental strand, 22016335 - 22016292
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
22016335 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgg |
22016292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #237
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 26089803 - 26089846
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
26089803 |
ttttggtccctgcaaatatgtctctttttggttttggtccctgg |
26089846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #238
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Complemental strand, 28552310 - 28552267
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
28552310 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgg |
28552267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #239
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Complemental strand, 31480427 - 31480384
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
31480427 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgg |
31480384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #240
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Complemental strand, 32119511 - 32119468
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
32119511 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgg |
32119468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #241
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 209
Target Start/End: Original strand, 47005227 - 47005266
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
47005227 |
ttttggtccctgcaaatatgtctcgttttggttttcgtcc |
47005266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #242
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Complemental strand, 49324073 - 49324030
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
49324073 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgg |
49324030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #243
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 157 - 216
Target Start/End: Complemental strand, 52403183 - 52403124
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaa |
216 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| | |||| |||||| ||||||||||| |
|
|
| T |
52403183 |
ggctaaaatatgcttttggtccctgcaaatatggcgagtttgggttttggtccctggtaa |
52403124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #244
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 54608591 - 54608634
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
54608591 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgg |
54608634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #245
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 170 - 212
Target Start/End: Complemental strand, 863579 - 863537
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
863579 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
863537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #246
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 158 - 208
Target Start/End: Complemental strand, 11463480 - 11463430
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
||||||||||||||| ||| ||||||| ||| |||||||||||||||||| |
|
|
| T |
11463480 |
gctaaaatatggtttcggtcgctgcaaaaatgcctcgttttggttttagtc |
11463430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #247
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 157 - 195
Target Start/End: Complemental strand, 26273824 - 26273786
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgt |
195 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
26273824 |
ggctaaaatatggttttagtcccagcaaatatgcctcgt |
26273786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #248
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 159 - 205
Target Start/End: Original strand, 30034109 - 30034155
Alignment:
| Q |
159 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
205 |
Q |
| |
|
||||||||||||||| |||| || ||||||| ||||||||||||||| |
|
|
| T |
30034109 |
ctaaaatatggttttggtccttgtaaatatgcctcgttttggtttta |
30034155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #249
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 178 - 212
Target Start/End: Original strand, 39132563 - 39132597
Alignment:
| Q |
178 |
cctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |
|
|
| T |
39132563 |
cctgcaaatatgtttcgttttggttttagtccctg |
39132597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #250
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 157 - 207
Target Start/End: Complemental strand, 40279335 - 40279285
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
207 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||| |||||| ||||||| |
|
|
| T |
40279335 |
ggctaaaatatggttttggtctttgcaaatatgtcttgttttgtttttagt |
40279285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #251
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 157 - 223
Target Start/End: Complemental strand, 45268629 - 45268563
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaa |
223 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||| | |||| |||||| |||||||||||| ||||| |
|
|
| T |
45268629 |
ggctaaaatatgtttttaatccctgcaaatatagcaagtttgggttttggtccctggtaaaaaaaaa |
45268563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #252
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 158 - 212
Target Start/End: Complemental strand, 46724901 - 46724847
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||| || |||||||||||| | |||||| |||||||||||| |
|
|
| T |
46724901 |
gctaaaatatggttttgatctctgcaaatatgttttgttttgattttagtccctg |
46724847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #253
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 170 - 204
Target Start/End: Complemental strand, 47114741 - 47114707
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggtttt |
204 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
47114741 |
tttttgtccctgcaaatatgtctcgttttggtttt |
47114707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #254
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 176 - 213
Target Start/End: Original strand, 1721166 - 1721203
Alignment:
| Q |
176 |
tccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
1721166 |
tccctgcaaatatgtctcgttttagttttggtccctgg |
1721203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #255
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 155 - 216
Target Start/End: Original strand, 4705679 - 4705740
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaa |
216 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||| | |||| |||||| ||||||||||| |
|
|
| T |
4705679 |
ttggctaaaatatgcttttgatccctgcaaatatggcgagtttaggttttggtccctggtaa |
4705740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #256
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 157 - 186
Target Start/End: Complemental strand, 10792970 - 10792941
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaat |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
10792970 |
ggctaaaatatggttttagtccctgcaaat |
10792941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #257
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 159 - 208
Target Start/End: Complemental strand, 19297947 - 19297898
Alignment:
| Q |
159 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
||||||||| ||||| |||| || ||||||||||||||||| |||||||| |
|
|
| T |
19297947 |
ctaaaatatagttttggtccttgtaaatatgtctcgttttgtttttagtc |
19297898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #258
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 157 - 210
Target Start/End: Original strand, 35936780 - 35936833
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccc |
210 |
Q |
| |
|
||||||||||||||||| |||||| ||||||| |||||||||||||| |||| |
|
|
| T |
35936780 |
ggctaaaatatggttttggtccctacaaatatacttcgttttggttttaatccc |
35936833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #259
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 159 - 188
Target Start/End: Original strand, 39819314 - 39819343
Alignment:
| Q |
159 |
ctaaaatatggttttagtccctgcaaatat |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
39819314 |
ctaaaatatggttttagtccctgcaaatat |
39819343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #260
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 170 - 211
Target Start/End: Original strand, 47336301 - 47336342
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccct |
211 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
47336301 |
ttttggtccctgcaaatatgtctcattttggttttggtccct |
47336342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #261
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 160 - 209
Target Start/End: Original strand, 53632506 - 53632555
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
||||||||||||||||||||| ||||||| ||||||| |||||||||| |
|
|
| T |
53632506 |
taaaatatggttttagtccctataaatatggttcgttttagttttagtcc |
53632555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #262
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 147 - 212
Target Start/End: Original strand, 54767161 - 54767226
Alignment:
| Q |
147 |
attttaaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||| ||| |||||||||||||||||| || ||| |||||| | | |||||||||||||||||| |
|
|
| T |
54767161 |
attttcaataggctaaaatatggttttattctctgaaaatatattttcttttggttttagtccctg |
54767226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #263
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 156 - 224
Target Start/End: Complemental strand, 977906 - 977838
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaa |
224 |
Q |
| |
|
||||| ||||||| |||| ||||||||||||||| | |||| |||||| |||| ||||||| |||||| |
|
|
| T |
977906 |
tggctgaaatatgcttttggtccctgcaaatatgacgagtttgggttttggtccttggtaaaaaaaaaa |
977838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #264
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 176 - 212
Target Start/End: Complemental strand, 8555229 - 8555193
Alignment:
| Q |
176 |
tccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
8555229 |
tccctgcaaatatgtcttgttttggttttggtccctg |
8555193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #265
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 157 - 229
Target Start/End: Original strand, 20404890 - 20404962
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtt |
229 |
Q |
| |
|
||||||||||||||||| | ||||||||||| |||||| |||||||||| ||| ||| ||||||||||| |
|
|
| T |
20404890 |
ggctaaaatatggttttgcttcctgcaaatatacctcgttatggttttagtttctgtaaaaaaaaaaattgtt |
20404962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #266
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 156 - 188
Target Start/End: Original strand, 27681325 - 27681357
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatat |
188 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
27681325 |
tggctaaaatatggttttggtccctgcaaatat |
27681357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #267
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 29686870 - 29686788
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaa--ttgtttttggtccc |
238 |
Q |
| |
|
||||||||||| ||||| ||||||||||| || |||||||||||||||| | | ||||| |||||| |||||||||||||| |
|
|
| T |
29686870 |
ggctaaaatatagttttgatccctgcaaatgtgcatcgttttggttttagt-ctttgtaaaaaaaaaatgttgtttttggtccc |
29686788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #268
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 156 - 208
Target Start/End: Complemental strand, 35533619 - 35533567
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
||||||||||||| |||| ||||| || ||||||||||||||| |||||||| |
|
|
| T |
35533619 |
tggctaaaatatgattttgctccctacacatatgtctcgttttgattttagtc |
35533567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #269
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 198 - 238
Target Start/End: Original strand, 45320661 - 45320701
Alignment:
| Q |
198 |
tggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
45320661 |
tggttttagtccctgtaaaaaaaaaaattgtttttggtccc |
45320701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #270
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 160 - 212
Target Start/End: Original strand, 51058593 - 51058645
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||||| |||| |||||| |||||||| ||||||||||| |
|
|
| T |
51058593 |
taaaatatggttttagtctctgctaatatgcatcgttttgactttagtccctg |
51058645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326 (Bit Score: 74; Significance: 9e-34; HSPs: 4)
Name: scaffold0326
Description:
Target: scaffold0326; HSP #1
Raw Score: 74; E-Value: 9e-34
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 4041 - 4122
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
4041 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttggtaaaaaaaaaattgtttttggtccc |
4122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #2
Raw Score: 74; E-Value: 9e-34
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 19223 - 19304
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
19223 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttggtaaaaaaaaaattgtttttggtccc |
19304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #3
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 4288 - 4207
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
4288 |
ggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccttggtaaaaaaaaaattgtttttggtccc |
4207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #4
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 19470 - 19389
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
19470 |
ggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccttggtaaaaaaaaaattgtttttggtccc |
19389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 74; Significance: 9e-34; HSPs: 164)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 74; E-Value: 9e-34
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 15076204 - 15076123
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
15076204 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccc |
15076123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 74; E-Value: 9e-34
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 33801743 - 33801662
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
33801743 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccc |
33801662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 1890452 - 1890371
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
1890452 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctggtaaaaaaaaaattgtttttggtccc |
1890371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 7155797 - 7155878
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
7155797 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccc |
7155878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 8681116 - 8681035
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
8681116 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctggtaaaaaaaaaattgtttttggtccc |
8681035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 30928681 - 30928761
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
30928681 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccct-gtaaaaaaaaaattgtttttggtccc |
30928761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 32885673 - 32885754
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
32885673 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccc |
32885754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 69; E-Value: 9e-31
Query Start/End: Original strand, 153 - 237
Target Start/End: Original strand, 23770157 - 23770240
Alignment:
| Q |
153 |
aattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtcc |
237 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
23770157 |
aatttgctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccct-gtaaaaaaaaaattgtttttggtcc |
23770240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 69; E-Value: 9e-31
Query Start/End: Original strand, 158 - 238
Target Start/End: Original strand, 31166871 - 31166951
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
31166871 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaataaaattgtttttggtccc |
31166951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 159 - 238
Target Start/End: Complemental strand, 5286949 - 5286870
Alignment:
| Q |
159 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
5286949 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctggtaaaaaaaaaattgtttttggtccc |
5286870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 148 - 238
Target Start/End: Complemental strand, 7156169 - 7156078
Alignment:
| Q |
148 |
ttttaaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaa-ttgtttttggtccc |
238 |
Q |
| |
|
|||||| | ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
7156169 |
ttttaagtaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaatttgtttttggtccc |
7156078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 161 - 239
Target Start/End: Original strand, 543365 - 543443
Alignment:
| Q |
161 |
aaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccca |
239 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
543365 |
aaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaatttgtttttggtccca |
543443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 155 - 237
Target Start/End: Complemental strand, 15962391 - 15962309
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtcc |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
15962391 |
ttggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaaattgtttttggtcc |
15962309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 157 - 233
Target Start/End: Complemental strand, 24274131 - 24274055
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttg |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
24274131 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaatttgtttttg |
24274055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 148 - 238
Target Start/End: Original strand, 8680766 - 8680857
Alignment:
| Q |
148 |
ttttaaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaa-ttgtttttggtccc |
238 |
Q |
| |
|
|||| ||| |||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
8680766 |
tttttaataggctaaaatatgtttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaatttgtttttggtccc |
8680857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 155 - 238
Target Start/End: Complemental strand, 31167202 - 31167120
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
31167202 |
ttggctaaaatatggttttagtccctgcaaatatggctcgttttgattttagtccctggtaaa-aaaaatttgtttttggtccc |
31167120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 152 - 238
Target Start/End: Complemental strand, 318102 - 318017
Alignment:
| Q |
152 |
aaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||||| |||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
318102 |
aaataggctaaaatatggttttaatccctgcaaatatgtttcgttttggttttagtccct-gtaaaaaaaaaattgtttttggtccc |
318017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 14655379 - 14655461
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaa-ttgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
14655379 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctggtaaaaaaaaaatttgtttttggtccc |
14655461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 22822651 - 22822569
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaa-ttgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
22822651 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctggtaaaaaaaaaatttgtttttggtccc |
22822569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 11448537 - 11448618
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||| | ||| |||||||||||||||||||| |
|
|
| T |
11448537 |
ggctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtccccgtaaaaaaaaaaattgtttttggtccc |
11448618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 151 - 238
Target Start/End: Complemental strand, 12419944 - 12419856
Alignment:
| Q |
151 |
taaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt-aaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||||||| |||||||||||||||||||||||| ||| ||||||||||||||| |||| |
|
|
| T |
12419944 |
taaataggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaaattgtttttgatccc |
12419856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 158 - 238
Target Start/End: Original strand, 14428651 - 14428730
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
14428651 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccct-gtaaaaaaaaaattgtttttggtccc |
14428730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 155 - 238
Target Start/End: Original strand, 494403 - 494485
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||| ||||| ||||||||||||||| |||| |
|
|
| T |
494403 |
ttggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt-ccttgtaaaaaaaaaattgtttttgatccc |
494485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 160 - 238
Target Start/End: Original strand, 10091039 - 10091115
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
10091039 |
taaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccct-gtaaa-aaaaaattgtttttggtccc |
10091115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 25431854 - 25431776
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||| ||||||||||||| |
|
|
| T |
25431854 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccct-gtaa--aaaaaaatgtttttggtccc |
25431776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 33808620 - 33808702
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt-aaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| ||||||||| |||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
33808620 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttgattttagtccctggtaaaaaaaaaaattgtttttggtccc |
33808702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 160 - 238
Target Start/End: Complemental strand, 34990312 - 34990234
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
34990312 |
taaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgtaaaaaaaaaaattgtttttggtccc |
34990234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 777677 - 777758
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||| ||||||||||||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
777677 |
ggctaaaatatgattttagttcctgcaaatatacctcgttttggttttagtccctggtaaaaaaaaatttgtttttggtccc |
777758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 6468310 - 6468391
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | ||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
6468310 |
ggctaaaatatggttttagtccctgcaaatatgctttgttttggttttagtccctgtgaaaaaaaaaattgtttttggtccc |
6468391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 21995064 - 21995145
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |||||||||||||||||||||| ||| |||||||||||| ||||||| |
|
|
| T |
21995064 |
ggctaaaatatggttttagtccctgcatatatgcctcgttttggttttagtccctgtaaaaaaaaaaattgtttatggtccc |
21995145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 26375693 - 26375773
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| ||||| ||||| ||||||||||||||| |||| |
|
|
| T |
26375693 |
ggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttaatccct-gtaaaaaaaaaattgtttttgttccc |
26375773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 156 - 237
Target Start/End: Complemental strand, 30929045 - 30928965
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtcc |
237 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||||||||||||||||||||| ||||| ||||| ||||||||||||| |
|
|
| T |
30929045 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccct-gtaaaaaaaaatttgtttttggtcc |
30928965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 158 - 238
Target Start/End: Complemental strand, 494751 - 494672
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| | ||| ||||| |||||||||||||| ||||| |
|
|
| T |
494751 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaat-ccttgtaaaaaaaaaattgtttttagtccc |
494672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 159 - 238
Target Start/End: Complemental strand, 6591440 - 6591360
Alignment:
| Q |
159 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt-aaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| ||||| ||| |||||||||||||||||||| |
|
|
| T |
6591440 |
ctaaaatatggttttagtacctgcaaatatgtctcgttttggttttagtttctggtaaaaaaaaaaattgtttttggtccc |
6591360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 157 - 236
Target Start/End: Complemental strand, 24692979 - 24692902
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtc |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||| || |||||||||||||||||| |
|
|
| T |
24692979 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgcttttagtccctg--caaaaaaaaattgtttttggtc |
24692902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 160 - 238
Target Start/End: Original strand, 1890062 - 1890141
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt-aaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||| ||||||| ||||||||| |||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
1890062 |
taaaatatggttttagtccctgtaaatatgcctcgttttgattttagtccctggtaaaaaaaaaaattgtttttggtccc |
1890141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 148 - 235
Target Start/End: Complemental strand, 33131859 - 33131773
Alignment:
| Q |
148 |
ttttaaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggt |
235 |
Q |
| |
|
||||||| ||||||||||||||||||||| |||||||||| ||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
33131859 |
ttttaaaaaggctaaaatatggttttagtctttgcaaatatgcctcgttttggttttagtccct-gtaaaaaaaaaattgtttttggt |
33131773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 317812 - 317890
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |||| |||||||||||||||||||| |
|
|
| T |
317812 |
ggctaaaatatagttttagtccctgcaaatatgtctcgttttggttttagcccct-gtaa--aaaaaattgtttttggtccc |
317890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 2615872 - 2615951
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
2615872 |
ggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtccct-ataaa-aaaaaattgtttttggtccc |
2615951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 160 - 238
Target Start/End: Complemental strand, 12176640 - 12176561
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaa--ttgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| | |||| |||||||||||||| |
|
|
| T |
12176640 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccct-gtaaaaagaaaattttgtttttggtccc |
12176561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 156 - 238
Target Start/End: Original strand, 34582528 - 34582611
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaa--attgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| ||||| |||||||||||||| |
|
|
| T |
34582528 |
tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct-gtaaaaaaaaacttttgtttttggtccc |
34582611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 160 - 238
Target Start/End: Complemental strand, 3356495 - 3356420
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||| || | |||||||||||||||||||| |
|
|
| T |
3356495 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccc---tataaaaaaaattgtttttggtccc |
3356420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 157 - 221
Target Start/End: Complemental strand, 10910964 - 10910900
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaa |
221 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
10910964 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaataaa |
10910900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 152 - 212
Target Start/End: Complemental strand, 19296412 - 19296352
Alignment:
| Q |
152 |
aaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
19296412 |
aaattggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctg |
19296352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 3968645 - 3968700
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3968645 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
3968700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 6412218 - 6412273
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6412218 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
6412273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 159 - 238
Target Start/End: Original strand, 9896280 - 9896357
Alignment:
| Q |
159 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |||| |||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
9896280 |
ctaaaatatggttttaatccctgcaaatatgtctcattttagttttagtccct-gtaaa-aaaaaattgtttttggtccc |
9896357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 147 - 237
Target Start/End: Original strand, 17771902 - 17771992
Alignment:
| Q |
147 |
attttaaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaa-ttgtttttggtcc |
237 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||| || ||| |||||| ||||||||||||| |
|
|
| T |
17771902 |
attttaaat-ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccttgtaaaaaaaaaaatttgtttttggtcc |
17771992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 19690393 - 19690448
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19690393 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
19690448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 21385251 - 21385306
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21385251 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
21385306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 22543718 - 22543663
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22543718 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
22543663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 23502540 - 23502485
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
23502540 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttactccctg |
23502485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 12419708 - 12419789
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaa-ttgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||||||| |||||| ||||||||| |||| |
|
|
| T |
12419708 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagt-cctggtaaaaaaaaaatttgtttttgttccc |
12419789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 15962027 - 15962109
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg-gtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |||||||||||||||||||||| ||| ||||| |||||||||||||| |
|
|
| T |
15962027 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgcagaaaaaaaaatttgtttttggtccc |
15962109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 155 - 233
Target Start/End: Complemental strand, 21995427 - 21995351
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttg |
233 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||| |||||||||| ||||| ||||||||||||||| |
|
|
| T |
21995427 |
ttggctaaaatatggttttagtccttgcaaatatgcctcgttttggctttagtccct-gtaaa-aaaaaattgtttttg |
21995351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 156 - 238
Target Start/End: Original strand, 30239292 - 30239373
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||||||||||||||||||||||||| |||| || || |||||||||||||| |
|
|
| T |
30239292 |
tggctaaaatatgattttagttcctgcaaatatgtctcgttttggttttagtccct-ataaaaaacaatttgtttttggtccc |
30239373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 31398541 - 31398460
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaatt-gtttttggtccc |
238 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| ||||||||||||||| || |||| |||||||| |||||||||||| |
|
|
| T |
31398541 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtccttg-taaaaaaaaaattagtttttggtccc |
31398460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 157 - 237
Target Start/End: Complemental strand, 12612359 - 12612278
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaa-attgtttttggtcc |
237 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |||||||| ||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
12612359 |
ggctaaaatatggtgttagtccctgcaaatatgcctcgttttagttttagtccctgtaaaataaaaattttgtttttggtcc |
12612278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 155 - 208
Target Start/End: Original strand, 24901237 - 24901290
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
24901237 |
ttggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
24901290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 778042 - 777959
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt--aaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||| |||||||| ||||| ||| |||||||||||||||||||| |
|
|
| T |
778042 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttagttttagtttctggtaaaaaaaaaaaattgtttttggtccc |
777959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 152 - 212
Target Start/End: Complemental strand, 1007514 - 1007454
Alignment:
| Q |
152 |
aaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
1007514 |
aaataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
1007454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 2373179 - 2373261
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg--gtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || ||||||||| ||||||||| ||||| |||||||||||||| ||||| |
|
|
| T |
2373179 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttatagtccctgtagtaaa-aaaaaattgtttttagtccc |
2373261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 3276354 - 3276302
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
3276354 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
3276302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #64
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 157 - 229
Target Start/End: Complemental strand, 3969009 - 3968939
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtt |
229 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
3969009 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccct-gtaaa-aaaaaattgtt |
3968939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #65
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 6591115 - 6591202
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgg------ttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |||||||||| ||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
6591115 |
ggctaaaatatggttttagtccccgcaaatatgcctcgttttggttttgattttagtccctggtaaaaaaaaatttgtttttggtccc |
6591202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #66
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 9896637 - 9896585
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
9896637 |
ggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtcc |
9896585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #67
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 157 - 229
Target Start/End: Original strand, 17765009 - 17765080
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtt |
229 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||| || ||||| ||||||||||| |
|
|
| T |
17765009 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtttct-gtaaaaaaaaaattgtt |
17765080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #68
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 157 - 229
Target Start/End: Original strand, 21993787 - 21993857
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtt |
229 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
21993787 |
ggctaaaatatggttttgctccctgcaaatatgtctcgttttggttttagtccct-gtaaa-aaaaaattgtt |
21993857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #69
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 160 - 212
Target Start/End: Complemental strand, 26376042 - 26375990
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
26376042 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
26375990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #70
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 3414387 - 3414442
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3414387 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
3414442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #71
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 3414752 - 3414697
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3414752 |
ggctaaaatatggttttggtccctgtaaatatgtctcgttttggttttagtccctg |
3414697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #72
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 208
Target Start/End: Complemental strand, 8170151 - 8170100
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
8170151 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
8170100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #73
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 155 - 238
Target Start/End: Complemental strand, 11129545 - 11129462
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||| |||||||||||||| || | || ||| |||||||||||||||||||| |
|
|
| T |
11129545 |
ttggctaaaatatgattttactccctgcaaatatgcctcgttttggttttcgttcttgtaaaaaaaaaaattgtttttggtccc |
11129462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #74
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 208
Target Start/End: Original strand, 12757610 - 12757661
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
12757610 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
12757661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #75
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 14656260 - 14656205
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
14656260 |
ggctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctg |
14656205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #76
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 18024375 - 18024320
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
18024375 |
ggctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtccctg |
18024320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #77
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 21994403 - 21994348
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
21994403 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
21994348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #78
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 22543354 - 22543409
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
22543354 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
22543409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #79
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 25137357 - 25137302
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
25137357 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
25137302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #80
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 31198615 - 31198670
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
31198615 |
ggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg |
31198670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #81
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 34582892 - 34582837
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
34582892 |
ggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtccctg |
34582837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #82
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 543724 - 543642
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaa-aaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| | |||||||||||| ||||||||||| ||| || |||||||||||||| |
|
|
| T |
543724 |
ggctaaaatatgattttagtccctgcaaatatgctttgttttggttttaatccctggtaaaaaaataatttgtttttggtccc |
543642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #83
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 156 - 238
Target Start/End: Original strand, 12176384 - 12176464
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||| || || |||||||||||||||| |||||||||| | ||||| |||||||||||||||||||| |
|
|
| T |
12176384 |
tggctaaaatatggttttagcccatgtaaatatgtctcgttttagttttagtccat-gtaaa-aaaaaattgtttttggtccc |
12176464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #84
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 160 - 238
Target Start/End: Complemental strand, 19276036 - 19275958
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||| |||||||||||| ||||||| ||| |||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
19276036 |
taaaatatagttttagtccctacaaatatacctcattttggttttagtccctgtaaaaaaaaaaattgtttttggtccc |
19275958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #85
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 146 - 212
Target Start/End: Complemental strand, 21385595 - 21385529
Alignment:
| Q |
146 |
tattttaaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||| ||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
21385595 |
tattttaaaaaggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg |
21385529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #86
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 157 - 223
Target Start/End: Original strand, 24273828 - 24273894
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaa |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||| |||| |||| ||||| |
|
|
| T |
24273828 |
ggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagttcctgataaaaaaaaa |
24273894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #87
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 177 - 238
Target Start/End: Original strand, 5286606 - 5286667
Alignment:
| Q |
177 |
ccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||| ||||||||| ||||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
5286606 |
ccctgcaaatatgcctcgttttgattttagtccttggtaaaaaaaaaattgtttttggtccc |
5286667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #88
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 160 - 238
Target Start/End: Complemental strand, 7324189 - 7324110
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaa--ttgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||| ||||| | |||| |||||||||||||| |
|
|
| T |
7324189 |
taaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccct-gtaaaaagaaaattttgtttttggtccc |
7324110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #89
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 159 - 212
Target Start/End: Original strand, 13617531 - 13617584
Alignment:
| Q |
159 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
13617531 |
ctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg |
13617584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #90
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 157 - 210
Target Start/End: Complemental strand, 22792899 - 22792846
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccc |
210 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
22792899 |
ggctaaaatatggttctagtccctgcaaatatgcctcgttttggttttagtccc |
22792846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #91
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 25136994 - 25137075
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||| |||||||||||||||||||||| ||| ||| |||||||||||||| |
|
|
| T |
25136994 |
ggctaaaatatggttttggtcgctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaattgttgtttttggtccc |
25137075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #92
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 2616240 - 2616154
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgg------ttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || ||||||| ||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
2616240 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttggttttagtccct-gtaaaaaaaaaattgtttttggtccc |
2616154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #93
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 3356142 - 3356194
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
3356142 |
ggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtcc |
3356194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #94
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 156 - 212
Target Start/End: Original strand, 10910628 - 10910684
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||||| ||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
10910628 |
tggctaaaatatggttttggtctctacaaatatgtctcgttttggttttagtccctg |
10910684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #95
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 155 - 211
Target Start/End: Original strand, 12298820 - 12298876
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccct |
211 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||||||||||| |||||||||||| |
|
|
| T |
12298820 |
ttggttaaaatatggttttggtccctgcaaatatgtctcgttttcgttttagtccct |
12298876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #96
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 157 - 229
Target Start/End: Complemental strand, 12299140 - 12299070
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtt |
229 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||||| ||| ||||| ||||||||||| |
|
|
| T |
12299140 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttcct-gtaaa-aaaaaattgtt |
12299070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #97
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 1007124 - 1007179
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
1007124 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
1007179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #98
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 6412579 - 6412524
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
6412579 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctg |
6412524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #99
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 11449169 - 11449114
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |||||||||||| ||||||||| |
|
|
| T |
11449169 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttggttgtagtccctg |
11449114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #100
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 13150750 - 13150695
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
13150750 |
ggctaaaatatggtattaacccctgcaaatatgtctcgttttggttttagtccctg |
13150695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #101
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 19129520 - 19129465
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
19129520 |
ggctaaaatatgattttggtccctgcaaatatgtcacgttttggttttagtccctg |
19129465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #102
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 20467718 - 20467663
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
20467718 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttcctg |
20467663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #103
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 21147404 - 21147459
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
21147404 |
ggctaaaatatggttttggtccctgcaaatatgcatcgttttggttttagtccctg |
21147459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #104
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 25121496 - 25121441
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| || ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
25121496 |
ggctaaaatatggttttggtgcctgcaaatatgtttcgttttggttttagtccctg |
25121441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #105
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 157 - 211
Target Start/End: Complemental strand, 1214996 - 1214942
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccct |
211 |
Q |
| |
|
||||||||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
1214996 |
ggctaaaatatggttttgatctctgcaaatatgtctcgttttggttttagtccct |
1214942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #106
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 157 - 211
Target Start/End: Original strand, 13268109 - 13268163
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccct |
211 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
13268109 |
ggctaaaatatggttttggtccctgcaaatatgcctcgtttaggttttagtccct |
13268163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #107
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 157 - 207
Target Start/End: Complemental strand, 19321131 - 19321081
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
207 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
19321131 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt |
19321081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #108
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 157 - 222
Target Start/End: Original strand, 22822307 - 22822373
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt-ccctggtaaataaaa |
222 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||||||| |||||||||| |||| |
|
|
| T |
22822307 |
ggctaaaatatggttttagtctctgcaaatatacctcgttttggttttagtaccctggtaaaaaaaa |
22822373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #109
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 158 - 238
Target Start/End: Original strand, 34989962 - 34990038
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||||||| ||||||||| |||| |||||||||||||||||||| |
|
|
| T |
34989962 |
gctaaaatatgcttttagtccctgcaaatatgcctcgttttgattttagtcc--tgtaa--aaaaaattgtttttggtccc |
34990038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #110
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 157 - 222
Target Start/End: Original strand, 14655903 - 14655968
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaa |
222 |
Q |
| |
|
|||||||| |||||||| |||||||||||||| | ||||||||||||||||||||| |||||||| |
|
|
| T |
14655903 |
ggctaaaacatggttttggtccctgcaaatatatttcgttttggttttagtccctgtaaaataaaa |
14655968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #111
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 15116673 - 15116753
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt--aaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||||||||||||||||| || ||| ||| |||||||||||||||||||| |
|
|
| T |
15116673 |
ggctaaaatatggttttagtcgctgcaaata--tctcgttttggttttagttcc-ggtaaaaaaaaaaaattgtttttggtccc |
15116753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #112
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 157 - 237
Target Start/End: Original strand, 19296108 - 19296185
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtcc |
237 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |||||||| ||||||||||| |||| |||||| |||||||||||| |
|
|
| T |
19296108 |
ggctaaaacatggttttagtccctgcaaatatgcgtcgttttgattttagtccct-gtaa--aaaaaaatgtttttggtcc |
19296185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #113
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 159 - 212
Target Start/End: Original strand, 19320769 - 19320822
Alignment:
| Q |
159 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
19320769 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttaatccctg |
19320822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #114
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 25431576 - 25431655
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||| ||||| |||||| |||||||| |||||||| ||||||| ||| ||||| |||||||||||||||||||| |
|
|
| T |
25431576 |
ggctaaaatatgattttaatccctgtaaatatgtttcgttttgattttagttcct-gtaaa-aaaaaattgtttttggtccc |
25431655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #115
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 156 - 229
Target Start/End: Complemental strand, 31186592 - 31186521
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtt |
229 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| |||||||| |||||||||||| ||||| ||||||||||| |
|
|
| T |
31186592 |
tggctaaaatatggtttttgtgcctgcaaatatgcctcgtttttgttttagtccct-gtaaa-aaaaaattgtt |
31186521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #116
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 157 - 213
Target Start/End: Original strand, 19129336 - 19129392
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
||||| ||||||| ||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
19129336 |
ggctacaatatggctttggtccctgcaaatatgcctcgttttggttttagtccctgg |
19129392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #117
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 156 - 212
Target Start/End: Original strand, 19267564 - 19267620
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
19267564 |
tggctaaaatatggttttggtccctgtaaatatgcttcgttttggttttagtccctg |
19267620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #118
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 160 - 212
Target Start/End: Original strand, 20467354 - 20467406
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
20467354 |
taaaatatagttttggtccctgcaaatatgcctcgttttggttttagtccctg |
20467406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #119
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 157 - 211
Target Start/End: Original strand, 6564581 - 6564636
Alignment:
| Q |
157 |
ggctaaaatatggttttag-tccctgcaaatatgtctcgttttggttttagtccct |
211 |
Q |
| |
|
||||||| ||||||||| | |||||||||||||||||||||||||||||||||||| |
|
|
| T |
6564581 |
ggctaaattatggtttttggtccctgcaaatatgtctcgttttggttttagtccct |
6564636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #120
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 157 - 208
Target Start/End: Complemental strand, 6564943 - 6564893
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
6564943 |
ggctaaaat-tggttttggtccctgcaaatatgtctcgttttggttttagtc |
6564893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #121
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 152 - 238
Target Start/End: Original strand, 12611990 - 12612077
Alignment:
| Q |
152 |
aaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaa-attgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| | ||||| |||||||| || | ||||||||| |||||||||||||| |
|
|
| T |
12611990 |
aaattggctaaaatatggtgttagtccctgcaaatatgccctgttttagttttagttcccgtaaaataaaaattttgtttttggtccc |
12612077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #122
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 15722610 - 15722665
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
15722610 |
ggctaaaatatggttttggtctatgcaaatatgtctcgttttgattttagtccctg |
15722665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #123
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 17765375 - 17765320
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||| |||||||||||| |
|
|
| T |
17765375 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttatttttagtccctg |
17765320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #124
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 154 - 209
Target Start/End: Complemental strand, 19690762 - 19690708
Alignment:
| Q |
154 |
attggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
|||||| ||||||||||||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
19690762 |
attggcgaaaatatggttttggtccctgcaaatatgtctcgtttt-gttttagtcc |
19690708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #125
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 157 - 204
Target Start/End: Original strand, 23502237 - 23502284
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttt |
204 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
23502237 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt |
23502284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #126
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 157 - 211
Target Start/End: Original strand, 1214696 - 1214750
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccct |
211 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
1214696 |
ggctaaaatattgttttggtccctgcaaatatgtcgcattttggttttagtccct |
1214750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #127
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 159 - 209
Target Start/End: Complemental strand, 14428948 - 14428898
Alignment:
| Q |
159 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
14428948 |
ctaaaatatggttttagtccttgcaaatatgcttcgttttggttttagtcc |
14428898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #128
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 15117040 - 15116963
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||| ||||||||| | |||| |||||||||||||||||||| |
|
|
| T |
15117040 |
ggctaaaatatggttttagtccctgcaaatatgcctc-ctttgattttagtccat-gtaa--aaaaaattgtttttggtccc |
15116963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #129
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 158 - 208
Target Start/End: Original strand, 23628799 - 23628849
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
|||||||||||||||| |||||||||||||| | ||||||||||||||||| |
|
|
| T |
23628799 |
gctaaaatatggttttggtccctgcaaatatatttcgttttggttttagtc |
23628849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #130
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 158 - 212
Target Start/End: Complemental strand, 30479421 - 30479367
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||| || | |||||||||| |||||||||||||||||||||| |
|
|
| T |
30479421 |
gctaaaatatggttttggttcatgcaaatatgcctcgttttggttttagtccctg |
30479367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #131
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 158 - 212
Target Start/End: Complemental strand, 31276339 - 31276285
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||| ||||| ||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
31276339 |
gctaaaataaagttttggtccctgcaaatatgtctcgttttgattttagtccctg |
31276285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #132
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 155 - 208
Target Start/End: Original strand, 11925737 - 11925790
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
|||||||| ||||| |||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
11925737 |
ttggctaatatatgattttggtccctgcaaatatgtctcgttttgattttagtc |
11925790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #133
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 18024009 - 18024066
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||| |||||||||||||| ||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
18024009 |
ttggataaaatatggttttggtctttgcaaatatgcctcgttttggttttagtccctg |
18024066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #134
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 157 - 198
Target Start/End: Complemental strand, 23770439 - 23770398
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgtttt |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
23770439 |
ggctaaaatatggttttagtccctgcaaatatgcctcgtttt |
23770398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #135
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 151 - 207
Target Start/End: Complemental strand, 11926039 - 11925983
Alignment:
| Q |
151 |
taaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
207 |
Q |
| |
|
||||| ||||||||||||||||| ||| ||| ||||||||| ||||||||||||||| |
|
|
| T |
11926039 |
taaataggctaaaatatggttttggtctctgaaaatatgtcgcgttttggttttagt |
11925983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #136
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 170 - 214
Target Start/End: Complemental strand, 19275223 - 19275179
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctggt |
214 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
19275223 |
ttttggtccctgcaaatatgtctcgttttggttttagtctctggt |
19275179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #137
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 158 - 202
Target Start/End: Original strand, 27764914 - 27764958
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtt |
202 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
27764914 |
gctaaaatatggttttagtccctacaaatatgtctcattttggtt |
27764958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #138
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 1214767 - 1214810
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
1214767 |
ttttggtccctgcaaatatgtcttgttttggttttagtccctgg |
1214810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #139
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 157 - 232
Target Start/End: Original strand, 7323864 - 7323940
Alignment:
| Q |
157 |
ggctaaaatatggttttagt----ccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgttttt |
232 |
Q |
| |
|
|||||||||||||||||| | || |||||||||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
7323864 |
ggctaaaatatggttttaattagcccttgcaaatatgtctcgttttggttttagtccct-gtaa--aaaaaattgttttt |
7323940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #140
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 169 - 212
Target Start/End: Complemental strand, 13617804 - 13617761
Alignment:
| Q |
169 |
gttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
13617804 |
gttttggtccctgcaaatatgcctcgttttggttttagtccctg |
13617761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #141
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 156 - 207
Target Start/End: Original strand, 15442936 - 15442987
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
207 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||| ||||||| |
|
|
| T |
15442936 |
tggctaaaatatggttttggtccctgcaaatatacctcgttttgattttagt |
15442987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #142
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 19267912 - 19267857
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| || |||| ||||||||| | |||||||||||||||||| |
|
|
| T |
19267912 |
ggctaaaatatggttttggttcctgtaaatatgtcccattttggttttagtccctg |
19267857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #143
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 157 - 208
Target Start/End: Original strand, 25121184 - 25121234
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
25121184 |
ggctaaaatatggttttcatcc-tgcaaatatgtctcgttttggttttagtc |
25121234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #144
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 163 - 202
Target Start/End: Complemental strand, 32885960 - 32885921
Alignment:
| Q |
163 |
aatatggttttagtccctgcaaatatgtctcgttttggtt |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
32885960 |
aatatggttttagtccctgcaaatatgtctcattttggtt |
32885921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #145
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 170 - 212
Target Start/End: Original strand, 13268182 - 13268224
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
13268182 |
ttttggtccctgcaaatatgtctcgttttggttttggtccctg |
13268224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #146
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 170 - 212
Target Start/End: Complemental strand, 19129447 - 19129405
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
19129447 |
ttttggtccctgcaaatatgtctcgttttggttttggtccctg |
19129405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #147
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 24901554 - 24901473
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||| |||| |||||| |||||||| || |||||||||||||||||| ||| ||| |||||||||||||| |
|
|
| T |
24901554 |
ggctaaaatatgattttggtccctacaaatatgacttattttggttttagtccctgtaaaaaaaattgttgtttttggtccc |
24901473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #148
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 30479063 - 30479108
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggtt |
202 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||||| |||||||||| |
|
|
| T |
30479063 |
ggctaaaatatggttttggtccctgtaaatatgtcccgttttggtt |
30479108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #149
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 154 - 198
Target Start/End: Complemental strand, 13268463 - 13268419
Alignment:
| Q |
154 |
attggctaaaatatggttttagtccctgcaaatatgtctcgtttt |
198 |
Q |
| |
|
||||||||||||| |||||| |||||||||||||||||| ||||| |
|
|
| T |
13268463 |
attggctaaaataaggttttggtccctgcaaatatgtctggtttt |
13268419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #150
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 1875502 - 1875557
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||| | |||| |||||||||||||| |||||||||| ||| ||||||| |
|
|
| T |
1875502 |
ggctaaaatatagctttaatccctgcaaatatgcctcgttttgggtttggtccctg |
1875557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #151
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 3968718 - 3968761
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
3968718 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgg |
3968761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #152
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Complemental strand, 6412506 - 6412463
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
6412506 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgg |
6412463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #153
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 12298891 - 12298934
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
12298891 |
ttttggtccatgcaaatatgtctcgttttggttttggtccctgg |
12298934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #154
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 157 - 224
Target Start/End: Complemental strand, 17517368 - 17517301
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaa |
224 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| | |||| ||||| |||||||||||| |||||| |
|
|
| T |
17517368 |
ggctaaaatatgtttttggtccctgcaaatatggcgagtttgagttttggtccctggtaaaaaaaaaa |
17517301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #155
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 153 - 188
Target Start/End: Complemental strand, 20897560 - 20897525
Alignment:
| Q |
153 |
aattggctaaaatatggttttagtccctgcaaatat |
188 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |
|
|
| T |
20897560 |
aattggctaaaatatggttttggtccctgcaaatat |
20897525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #156
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 21385324 - 21385367
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
21385324 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgg |
21385367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #157
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Complemental strand, 21994330 - 21994287
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
21994330 |
ttttggtccctgcaaatatgtctctttttggttttggtccctgg |
21994287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #158
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Complemental strand, 22543645 - 22543602
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
22543645 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgg |
22543602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #159
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Complemental strand, 27765101 - 27765058
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
27765101 |
ttttggtccctgcaaatatgtctcgttttggttttggtctctgg |
27765058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #160
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 170 - 212
Target Start/End: Complemental strand, 19267841 - 19267799
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
19267841 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
19267799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #161
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 161 - 207
Target Start/End: Original strand, 19275044 - 19275090
Alignment:
| Q |
161 |
aaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
207 |
Q |
| |
|
||||||||||||||| | ||||| |||||| |||||||||||||||| |
|
|
| T |
19275044 |
aaaatatggttttaggctctgcagatatgtttcgttttggttttagt |
19275090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #162
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 157 - 205
Target Start/End: Complemental strand, 12757936 - 12757888
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
205 |
Q |
| |
|
|||||||| ||| |||| |||||||||||||||| || ||||||||||| |
|
|
| T |
12757936 |
ggctaaaacatgattttggtccctgcaaatatgtatccttttggtttta |
12757888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #163
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 158 - 214
Target Start/End: Complemental strand, 23629101 - 23629045
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt |
214 |
Q |
| |
|
|||||||||||||||| || ||| |||||||||||| |||| ||||| ||| ||||| |
|
|
| T |
23629101 |
gctaaaatatggttttggttcctacaaatatgtctcattttagttttggtctctggt |
23629045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #164
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 160 - 196
Target Start/End: Complemental strand, 27765173 - 27765137
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgtt |
196 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
27765173 |
taaaatatggttttggtccctgcaaatatatctcgtt |
27765137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 74; Significance: 9e-34; HSPs: 188)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 74; E-Value: 9e-34
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 18633599 - 18633680
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
18633599 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccc |
18633680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 15635707 - 15635626
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
15635707 |
ggctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaattgtttttggtccc |
15635626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 38496782 - 38496701
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
38496782 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctggtaaaaaaaaatttgtttttggtccc |
38496701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 155 - 237
Target Start/End: Original strand, 28550825 - 28550906
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtcc |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
28550825 |
ttggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgttaaa-aaaaaattgtttttggtcc |
28550906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 4203770 - 4203690
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
4203770 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccct-gtaaaaaaaaaattgtttttggtccc |
4203690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 7075572 - 7075652
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
7075572 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct-gtaaaaaaaaaattgtttttggtccc |
7075652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 21124913 - 21124994
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
21124913 |
ggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaaaattgtttttggtccc |
21124994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 29172886 - 29172805
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| || || |||||||||||||| |
|
|
| T |
29172886 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaagaatttgtttttggtccc |
29172805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 155 - 238
Target Start/End: Complemental strand, 18633963 - 18633879
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt-aaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||| ||| |||||||||||||||||||| |
|
|
| T |
18633963 |
ttggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttactccctggtaaaaaaaaaaattgtttttggtccc |
18633879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 158 - 237
Target Start/End: Original strand, 29172524 - 29172604
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaa-ttgtttttggtcc |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
29172524 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaatttgtttttggtcc |
29172604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 156 - 238
Target Start/End: Original strand, 25561704 - 25561787
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt-aaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
25561704 |
tggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctggtaaaaaaaaaaattgtttttggtccc |
25561787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 156 - 238
Target Start/End: Complemental strand, 40029498 - 40029418
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
40029498 |
tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct-gtaaa-aaaaaattgtttttggtccc |
40029418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 2217854 - 2217774
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
2217854 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct-ataaaaaaaaaattgtttttggtccc |
2217774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 10744054 - 10743974
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| ||||| |||||||||||||| |
|
|
| T |
10744054 |
ggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccct-gtaaaaaaaaatttgtttttggtccc |
10743974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 16038377 - 16038458
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||| || ||| |||||||||||||||||||| |
|
|
| T |
16038377 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgtaaaaaaaaaaattgtttttggtccc |
16038458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 29151851 - 29151770
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||||||||||||| ||||||||| ||| |||||||||||||||| |
|
|
| T |
29151851 |
ggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagttcctggtaaaaaaataattgtttttggtccc |
29151770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 29875400 - 29875481
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||| ||||||||||||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
29875400 |
ggctaaaatatgattttaatccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaatttgtttttggtccc |
29875481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 35166158 - 35166078
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
35166158 |
ggctataatatggttttagtccctgcaaaaatgtctcgttttggttttagtccctggtaaa-aaaaaattatttttggtccc |
35166078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 157 - 234
Target Start/End: Original strand, 36577722 - 36577797
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttgg |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
36577722 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccct-gtaaa-aaaaaattgtttttgg |
36577797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 38786159 - 38786239
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
38786159 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccct-gtaaaaaaaaaattgtttttggtccc |
38786239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 42207242 - 42207322
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||| || ||||||||||||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
42207242 |
ggctaaaatatggttttagtccttgtaaatatgtctcgttttggttttagtccct-gtaaaaaaaaaattgtttttggtccc |
42207322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 157 - 237
Target Start/End: Complemental strand, 26133413 - 26133333
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtcc |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||| |||||||| |||| |
|
|
| T |
26133413 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaaatttgttttttgtcc |
26133333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 157 - 236
Target Start/End: Complemental strand, 29875725 - 29875645
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaa-attgtttttggtc |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
29875725 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaagaaaaattttgtttttggtc |
29875645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 157 - 237
Target Start/End: Complemental strand, 35167165 - 35167085
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtcc |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||| ||||| ||||||||||||| |
|
|
| T |
35167165 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaaaatttgtttttggtcc |
35167085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 157 - 237
Target Start/End: Complemental strand, 36578083 - 36578004
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtcc |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| ||||| ||||||||||||| |
|
|
| T |
36578083 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct-gtaaaaaaaaatttgtttttggtcc |
36578004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 2217494 - 2217576
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg-gtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
2217494 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaaaattgtttttggtccc |
2217576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 160 - 238
Target Start/End: Original strand, 15635379 - 15635457
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||| |||| | ||||||||||||| |
|
|
| T |
15635379 |
taaaatatggttttagtccatgcaaatatgtcttgttttggttttagtccctggtaaaaaaaataatgtttttggtccc |
15635457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 24781989 - 24782071
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt-aaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||| | ||| ||||| |||||||||||||| |
|
|
| T |
24781989 |
ggctaaaatatggttttagtcactgcaaatatgtctcgttttggttttagtccctgttaaaagaaaaatttgtttttggtccc |
24782071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 30800494 - 30800572
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
30800494 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct-gtaa--aaaaaattgtttttggtccc |
30800572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 153 - 236
Target Start/End: Complemental strand, 33336030 - 33335945
Alignment:
| Q |
153 |
aattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg--gtaaataaaaaattgtttttggtc |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
33336030 |
aattggctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctgtaaaaaaaaaaaaattgtttttggtc |
33335945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 148 - 238
Target Start/End: Complemental strand, 40168017 - 40167927
Alignment:
| Q |
148 |
ttttaaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||| ||| ||||||||||| |||||||||| ||||||||||||||||||||||||||||||||| ||| ||||| |||||||||||||| |
|
|
| T |
40168017 |
tttttaataggctaaaatattgttttagtccatgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaaatttgtttttggtccc |
40167927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 155 - 224
Target Start/End: Complemental strand, 6118501 - 6118432
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaa |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||| |||||| |
|
|
| T |
6118501 |
ttggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctggtaaaaaaaaaa |
6118432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 9179920 - 9179840
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||||||||||||||| ||||| ||||| |||||||||||||||||||| |
|
|
| T |
9179920 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttattccct-gtaaaaaaaaaattgtttttggtccc |
9179840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 10743724 - 10743805
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||| || ||| |||||| ||||||||||||| |
|
|
| T |
10743724 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgtaaaaaaaaaaaatgtttttggtccc |
10743805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 155 - 235
Target Start/End: Original strand, 29151514 - 29151595
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaa-ttgtttttggt |
235 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
29151514 |
ttggctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagtccctggtaaaaaaaaaatttgtttttggt |
29151595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 34125307 - 34125387
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| ||||||||||||||||| ||| ||||| |||||||||||||||||||| |
|
|
| T |
34125307 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt-ccttgtaaaaaaaaaattgtttttggtccc |
34125387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 157 - 237
Target Start/End: Original strand, 14318045 - 14318123
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtcc |
237 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||| ||| ||||| ||||||||||||||||||| |
|
|
| T |
14318045 |
ggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagt-ccttgtaaa-aaaaaattgtttttggtcc |
14318123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 157 - 224
Target Start/End: Original strand, 10408928 - 10408995
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaa |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
10408928 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctggtaaaaaaaaaa |
10408995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 153 - 212
Target Start/End: Complemental strand, 29366953 - 29366894
Alignment:
| Q |
153 |
aattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
29366953 |
aattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
29366894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 154 - 229
Target Start/End: Complemental strand, 35928461 - 35928388
Alignment:
| Q |
154 |
attggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtt |
229 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
35928461 |
attggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct-gtaaa-aaaaaattgtt |
35928388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 5950176 - 5950254
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||| |||||| ||||||||||||| |
|
|
| T |
5950176 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct-gtaa--aaaaaaatgtttttggtccc |
5950254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 10409326 - 10409244
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaa-ttgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||| |||||||| |||||||| |||||| ||||||||| |||| |
|
|
| T |
10409326 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtctctggtaaaaaaaaaatttgtttttgatccc |
10409244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 156 - 238
Target Start/End: Complemental strand, 21050914 - 21050834
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| ||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
21050914 |
tggctaaaatatggttttagtccctgcaaatatgcatcgttttgattttagtccct-gtaaa-aaaaaattgtttttggtccc |
21050834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 156 - 238
Target Start/End: Original strand, 26133182 - 26133262
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| ||||||||||||||||||||| ||||| |||||| ||||||||||||| |
|
|
| T |
26133182 |
tggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccct-gtaaa-aaaaaaatgtttttggtccc |
26133262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 31037741 - 31037659
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaa-taaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| || ||| ||| |||||||||||||||||||| |
|
|
| T |
31037741 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttattctctgtaaaacaaaaaaattgtttttggtccc |
31037659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 39379610 - 39379528
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaa-aattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||| |||| | |||||||||||||| |
|
|
| T |
39379610 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccttggtaaaaaaaacatttgtttttggtccc |
39379528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 9179593 - 9179674
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||||||||||||||||||||| ||| ||||||||| |||||||||| |
|
|
| T |
9179593 |
ggctaaaatatggttttagtccttgcaaatatgattcgttttggttttagtccctgtaaaaaaaaaaattgattttggtccc |
9179674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 28863510 - 28863589
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| ||||| ||||||||| |||| |
|
|
| T |
28863510 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct-gtaaa-aaaaagttgtttttgctccc |
28863589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 28863840 - 28863783
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
28863840 |
ttggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
28863783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 40029141 - 40029220
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| ||||| ||||| |||||||||||||| ||||| |
|
|
| T |
40029141 |
ggctaaaatatggttttagtccctgtaaatatgtctcgttttggttttaatccct-gtaaa-aaaaaattgtttttcgtccc |
40029220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 40167786 - 40167865
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| ||||||||||||||||||||| ||||| |||||| ||||||||||||| |
|
|
| T |
40167786 |
ggctaaagtatggttttagtccctgcaaatatgcctcgttttggttttagtccct-gtaaa-aaaaaaatgtttttggtccc |
40167865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 156 - 212
Target Start/End: Original strand, 45137 - 45193
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45137 |
tggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
45193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 157 - 229
Target Start/End: Original strand, 1381247 - 1381317
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtt |
229 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
1381247 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct-gtaaa-aaaaaattgtt |
1381317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 29692744 - 29692826
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaa--attgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| ||||| |||||||||||||| |
|
|
| T |
29692744 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct-gtaaaaaaaaagttttgtttttggtccc |
29692826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 155 - 237
Target Start/End: Original strand, 3850297 - 3850378
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttgg-ttttagtccctggtaaataaaaaattgtttttggtcc |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || |||||||||| ||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
3850297 |
ttggctaaaatatggttttagtccctgcaaatctgcctcgttttggtttttagtccct-gtaaa-aaaaaattgtttttggtcc |
3850378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 3850599 - 3850544
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3850599 |
ggctgaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
3850544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 5917126 - 5917181
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5917126 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
5917181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 164 - 238
Target Start/End: Original strand, 6118139 - 6118214
Alignment:
| Q |
164 |
atatggttttagtccctgcaaatatgtctcgttttgg-ttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||||| ||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
6118139 |
atatggttttagtctctgcaaatatgcctcgttttgggttttagtccctggtaaaaaaaaaattgtttttgatccc |
6118214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 18046038 - 18046093
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
18046038 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
18046093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 19565467 - 19565522
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19565467 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
19565522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 19685017 - 19685072
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19685017 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
19685072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 157 - 224
Target Start/End: Complemental strand, 25561999 - 25561932
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaa |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||| || |||||||| |||||| |
|
|
| T |
25561999 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatctctggtaaaaaaaaaa |
25561932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 30800850 - 30800795
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
30800850 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
30800795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 30888160 - 30888215
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30888160 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
30888215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 160 - 223
Target Start/End: Original strand, 39379242 - 39379305
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaa |
223 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
39379242 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaa |
39379305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 159 - 229
Target Start/End: Complemental strand, 6912855 - 6912787
Alignment:
| Q |
159 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtt |
229 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
6912855 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct-gtaaa-aaaaaattgtt |
6912787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 157 - 236
Target Start/End: Original strand, 4203456 - 4203532
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtc |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||| || || | |||||||||||||||||| |
|
|
| T |
4203456 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtgcc---tataaaaaaaattgtttttggtc |
4203532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 11799458 - 11799379
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||||||||||||||||||||| ||||| ||| || ||||||||||||| |
|
|
| T |
11799458 |
ggctaaaatatggttttagtccgtgcaaatatgcctcgttttggttttagtccct-gtaaa-aaataaatgtttttggtccc |
11799379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 148 - 209
Target Start/End: Complemental strand, 18046357 - 18046296
Alignment:
| Q |
148 |
ttttaaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
|||||| | ||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
18046357 |
ttttaattaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
18046296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 21050575 - 21050655
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||| |||||||| ||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
21050575 |
ggctaaaatatgattttagtccctacaaatatgcttcgttttgattttagtccct-gtaaaaaaaaaattgtttttggtccc |
21050655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 157 - 237
Target Start/End: Original strand, 23381950 - 23382027
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtcc |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||| ||| |||| |||||| |||||||||||| |
|
|
| T |
23381950 |
ggctaaaatatggttttagtccctgcaaatatgtctggttttggttttagttcct-gtaa--aaaaaaatgtttttggtcc |
23382027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 29693090 - 29693011
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |||||||||||||||| ||| ||||| |||||||||||||||||||| |
|
|
| T |
29693090 |
ggctaaaatatgattttagtccctgcaaatatgcttcgttttggttttagt-ccttgtaaa-aaaaaattgtttttggtccc |
29693011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 2032940 - 2032888
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2032940 |
ggctaaattatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
2032888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 5614166 - 5614218
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
5614166 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtcc |
5614218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 5614530 - 5614448
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaa--ttgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||| ||| ||||| | |||| |||||||||||||| |
|
|
| T |
5614530 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcct-gtaaaaagaaaattttgtttttggtccc |
5614448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 156 - 212
Target Start/End: Original strand, 6912496 - 6912552
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
6912496 |
tggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
6912552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 157 - 233
Target Start/End: Original strand, 11799129 - 11799205
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttg |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | ||||||||||||||||||| ||| ||||| ||||||||| |
|
|
| T |
11799129 |
ggctaaaatatggttttagtccctgcaaatatgcattgttttggttttagtccctgcgaaaaaaaaatttgtttttg |
11799205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 159 - 238
Target Start/End: Complemental strand, 16038738 - 16038658
Alignment:
| Q |
159 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg-gtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |||||||||||||||||| ||| ||| |||||||||||||||||||| |
|
|
| T |
16038738 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtctctgtaaaaaaaaaaaattgtttttggtccc |
16038658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 18258527 - 18258475
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
18258527 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
18258475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #80
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 157 - 229
Target Start/End: Complemental strand, 19685380 - 19685310
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtt |
229 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
19685380 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccct-gtaaa-aaaaaattgtt |
19685310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #81
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 152 - 208
Target Start/End: Original strand, 20690728 - 20690784
Alignment:
| Q |
152 |
aaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
20690728 |
aaataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
20690784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #82
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 157 - 229
Target Start/End: Complemental strand, 24443744 - 24443674
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtt |
229 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
24443744 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccct-gtaaa-aaaaaattgtt |
24443674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #83
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 157 - 229
Target Start/End: Complemental strand, 35877052 - 35876982
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtt |
229 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||| |||| ||||| ||||||||||| |
|
|
| T |
35877052 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagcccct-gtaaa-aaaaaattgtt |
35876982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #84
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 155 - 207
Target Start/End: Original strand, 38962804 - 38962856
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
207 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
38962804 |
ttggctaaaatatggttttagtccctgtaaatatgtctcgttttggttttagt |
38962856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #85
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 1105148 - 1105093
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
1105148 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
1105093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #86
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 1381611 - 1381556
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
1381611 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
1381556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #87
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 4736542 - 4736487
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4736542 |
ggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctg |
4736487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #88
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 5917460 - 5917405
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
5917460 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
5917405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #89
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 19565831 - 19565776
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
19565831 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
19565776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #90
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 159 - 238
Target Start/End: Complemental strand, 27850372 - 27850294
Alignment:
| Q |
159 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||||||||||||||||| |||| |||| |||||||||||||| |
|
|
| T |
27850372 |
ctaaaatatgattttagtctctgcaaatatgtctcgttttggttttagtccct-ataaaaaaaattttgtttttggtccc |
27850294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #91
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 35928064 - 35928119
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
35928064 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
35928119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #92
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 37271706 - 37271651
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
37271706 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttgattttagtccctg |
37271651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #93
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 38170514 - 38170569
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
38170514 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
38170569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #94
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 40764415 - 40764470
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
40764415 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
40764470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #95
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 34125632 - 34125554
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| ||| ||||||||||||||||| |||| |||||||||||||| ||||| |
|
|
| T |
34125632 |
ggctaaaatatggttttagtccctgtaaatatgcctcattttggttttagtccct-gtaa--aaaaaattgttttttgtccc |
34125554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #96
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 155 - 208
Target Start/End: Original strand, 2636667 - 2636720
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
2636667 |
ttggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtc |
2636720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #97
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 20985723 - 20985780
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
20985723 |
ttggttaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
20985780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #98
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 152 - 209
Target Start/End: Complemental strand, 23382302 - 23382245
Alignment:
| Q |
152 |
aaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
23382302 |
aaatcggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtcc |
23382245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #99
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 293828 - 293880
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
293828 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtcc |
293880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #100
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 157 - 229
Target Start/End: Original strand, 1104858 - 1104928
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtt |
229 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||| ||||||||||| ||||| ||||||||||| |
|
|
| T |
1104858 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccct-gtaaa-aaaaaattgtt |
1104928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #101
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 160 - 237
Target Start/End: Complemental strand, 9532532 - 9532453
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg--gtaaataaaaaattgtttttggtcc |
237 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||||||||||||| || ||| ||||||||||||||||||| |
|
|
| T |
9532532 |
taaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccttgtaaaaaaaaaaaaattgtttttggtcc |
9532453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #102
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 13990895 - 13990843
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
13990895 |
ggctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
13990843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #103
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 155 - 211
Target Start/End: Original strand, 15916284 - 15916340
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccct |
211 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
15916284 |
ttggctaaaagatggttttggtccctgcaaatatgtctcattttggttttagtccct |
15916340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #104
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 157 - 229
Target Start/End: Original strand, 18258162 - 18258233
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtt |
229 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| ||||||||||||||||| | ||| ||||||||||| |
|
|
| T |
18258162 |
ggctaaaatatggttttggtccctgcaaatatggctcattttggttttagtccct-gcaaaaaaaaaattgtt |
18258233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #105
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 20660948 - 20661000
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
20660948 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
20661000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #106
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 159 - 207
Target Start/End: Complemental strand, 35609635 - 35609587
Alignment:
| Q |
159 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
207 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
35609635 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
35609587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #107
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 157 - 229
Target Start/End: Original strand, 37271359 - 37271429
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtt |
229 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||| ||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
37271359 |
ggctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtccct-gtaaa-aaaaaattgtt |
37271429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #108
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 156 - 208
Target Start/End: Original strand, 42553641 - 42553693
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
42553641 |
tggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtc |
42553693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #109
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 158 - 209
Target Start/End: Complemental strand, 2636992 - 2636941
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
2636992 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
2636941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #110
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 3851329 - 3851274
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
3851329 |
ggctaaaatatggttttagtccctcaaaatatgtctcgttttgattttagtccctg |
3851274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #111
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 17070863 - 17070808
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||| ||||||| ||||| |
|
|
| T |
17070863 |
ggctaaaatatggttttagtccctacaaatatgtctcgttttcgttttagaccctg |
17070808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #112
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 20986089 - 20986034
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
20986089 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctg |
20986034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #113
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 24443380 - 24443435
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
24443380 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg |
24443435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #114
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 35876688 - 35876743
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
35876688 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
35876743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #115
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 36973710 - 36973655
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
36973710 |
ggctaaaatatggttttggtccctggaaatatgtctcgttttgattttagtccctg |
36973655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #116
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 40764780 - 40764725
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
40764780 |
ggctaaaatatggttttgctccctgcaaatatgcctcgttttggttttagtccctg |
40764725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #117
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 157 - 223
Target Start/End: Original strand, 20416360 - 20416425
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaa |
223 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| |||||||| |||||| |||||| ||||| |
|
|
| T |
20416360 |
ggctaaaatatggttttcgtccctgcaaatatgtctcgctttggtttaagtccc-ggtaaaaaaaaa |
20416425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #118
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 153 - 207
Target Start/End: Original strand, 36973349 - 36973403
Alignment:
| Q |
153 |
aattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
207 |
Q |
| |
|
||||||||||||||||||||| ||| || |||||||||||||||||||||||||| |
|
|
| T |
36973349 |
aattggctaaaatatggttttggtctctccaaatatgtctcgttttggttttagt |
36973403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #119
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 38496420 - 38496501
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt-aaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||| |||||||||| || |||||||||| ||||||||||||||| |||| ||| |||||||||||||||||||| |
|
|
| T |
38496420 |
ggctaaaatatagttttagtccttgtaaatatgtct-attttggttttagtccttggtaaaaaaaaaaattgtttttggtccc |
38496501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #120
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 154 - 212
Target Start/End: Complemental strand, 42596820 - 42596762
Alignment:
| Q |
154 |
attggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
42596820 |
attggttaaaatatggttttggtccctgcaaatatgactcgttttagttttagtccctg |
42596762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #121
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 155 - 205
Target Start/End: Original strand, 42994066 - 42994116
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
42994066 |
ttggctaaaatatggttttagtccctgcaaatatgactcgttttgatttta |
42994116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #122
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 20661313 - 20661256
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
20661313 |
ttggctaaaatatggttttggtccgtgcaaatatgcttcgttttggttttagtccctg |
20661256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #123
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 157 - 233
Target Start/End: Complemental strand, 25779162 - 25779085
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg-gtaaataaaaaattgtttttg |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || ||||||||||||| |||| ||| ||||||||||||||| |
|
|
| T |
25779162 |
ggctaaaatatggttttagtccctgcaaatatgcttcattttggttttagttcctgtaaaaaaaaaaaattgtttttg |
25779085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #124
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 32108808 - 32108889
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| ||||||| |||||| |||||| ||| ||| |||||||||||||| |
|
|
| T |
32108808 |
ggctaaaatatggttttggtccctgcaaatatgtttcgttttagttttaatccctgtaaaaaaaattgttgtttttggtccc |
32108889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #125
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 157 - 206
Target Start/End: Original strand, 35166911 - 35166960
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttag |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || ||||||||||||| |
|
|
| T |
35166911 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttag |
35166960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #126
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 152 - 212
Target Start/End: Original strand, 12144902 - 12144962
Alignment:
| Q |
152 |
aaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||| ||||||||||||||||| ||||||| ||||||| ||| |||||||||||||||||| |
|
|
| T |
12144902 |
aaataggctaaaatatggtttttgtccctgtaaatatgcctctttttggttttagtccctg |
12144962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #127
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 160 - 212
Target Start/End: Complemental strand, 26071613 - 26071561
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26071613 |
taaaatatgattttgatccctgcaaatatgtctcgttttggttttagtccctg |
26071561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #128
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 160 - 208
Target Start/End: Complemental strand, 27916761 - 27916713
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
27916761 |
taaaatatggttttattccctgcaaatatgcctcgttttggttttagtc |
27916713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #129
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 160 - 212
Target Start/End: Complemental strand, 28108159 - 28108107
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||| |||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
28108159 |
taaaatatggttttggtccctacaaatatgcctcgttttggttttagtccctg |
28108107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #130
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 28213373 - 28213425
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
28213373 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtcc |
28213425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #131
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 159 - 238
Target Start/End: Original strand, 31037397 - 31037477
Alignment:
| Q |
159 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaa-ttgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||| || |||||| |||||||| ||| |||||||||| |||||||| ||||| |
|
|
| T |
31037397 |
ctaaaatatggttttagtccctgcaaatataccttgttttgattttagtctctgtaaaataaaaaatttgttttttgtccc |
31037477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #132
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 156 - 212
Target Start/End: Original strand, 35609302 - 35609358
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
35609302 |
tggctaaaatatggttttggtccatgcaaatatgcatcgttttggttttagtccctg |
35609358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #133
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 1286682 - 1286737
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||| || |||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
1286682 |
ggctaaaatatggtgttggtccctacaaatatgcctcgttttggttttagtccctg |
1286737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #134
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 156 - 207
Target Start/End: Complemental strand, 5104002 - 5103951
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
207 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||| ||||||||||||| |
|
|
| T |
5104002 |
tggctaaaatatggttttggttcctgcaaatatgtctcattttggttttagt |
5103951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #135
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 154 - 213
Target Start/End: Complemental strand, 12145186 - 12145127
Alignment:
| Q |
154 |
attggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||||||||||||| |||| ||| |||| |
|
|
| T |
12145186 |
attgactaaaatatggttttggtccctgcaaatatgtctcgttttgattttggtctctgg |
12145127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #136
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 17070535 - 17070589
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
17070535 |
ggctaaaatatggttttggtccctgcaaatatgtctcg-tttgattttagtccctg |
17070589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #137
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 160 - 223
Target Start/End: Complemental strand, 20418013 - 20417950
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaa |
223 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||||| |||||||||| | ||||||||| |
|
|
| T |
20418013 |
taaaatatggtttaagtctctgcaaatatgtctcgttttgattttagtccccgtaaaataaaaa |
20417950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #138
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 20683747 - 20683802
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||||||| |||||||||||| |
|
|
| T |
20683747 |
ggctaaaatatggttttagtctctgcaaatatgcatcgttttgattttagtccctg |
20683802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #139
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 26071291 - 26071346
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
26071291 |
ggctaaaatatagtttcggtccctgcaaatatgtctcattttggttttagtccctg |
26071346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #140
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 28871994 - 28871939
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||| ||||||||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
28871994 |
ggctaaattatggttttggtccctgcaaatatgcctcgttttggttttagttcctg |
28871939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #141
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 157 - 207
Target Start/End: Complemental strand, 18286741 - 18286691
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
207 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
18286741 |
ggctaaaaaatggttttagtccctgcaaatatacctcgttttggttttagt |
18286691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #142
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 158 - 212
Target Start/End: Original strand, 27916462 - 27916516
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||| | ||||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
27916462 |
gctaaaatatgatcttagttcctgcaaatatgtttcgttttggttttagtccctg |
27916516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #143
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 159 - 205
Target Start/End: Complemental strand, 38452394 - 38452348
Alignment:
| Q |
159 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
205 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
38452394 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttgatttta |
38452348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #144
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 160 - 205
Target Start/End: Complemental strand, 45501 - 45456
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
205 |
Q |
| |
|
|||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
45501 |
taaaatatggttttggtccctgcaaatatgtttcgttttggtttta |
45456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #145
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 153 - 209
Target Start/End: Complemental strand, 9588616 - 9588559
Alignment:
| Q |
153 |
aattggctaaaatatggttttag-tccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
|||| ||||||||||| |||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
9588616 |
aattagctaaaatatgatttttggtccctgcaaatatgtctcgttttggttttagtcc |
9588559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #146
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 16616370 - 16616419
Alignment:
| Q |
159 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| |||| ||||||||| |
|
|
| T |
16616370 |
ctaaaatatggttttagtccctgcaaatatgcctcattttagttttagtc |
16616419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #147
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 160 - 205
Target Start/End: Original strand, 18286431 - 18286476
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
205 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
18286431 |
taaaatatggttttagttcctgcaaatatgtcttgttttggtttta |
18286476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #148
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 24782274 - 24782195
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||| ||||||||| | |||||||| ||||||||| ||||||||||| ||||| || ||||||||||||||||| |
|
|
| T |
24782274 |
ggctaaaatataattttagtcc-tacaaatatgcctcgttttgattttagtccct-gtaaaaaataaattgtttttggtccc |
24782195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #149
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 160 - 229
Target Start/End: Original strand, 28871640 - 28871708
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtt |
229 |
Q |
| |
|
||||||||| |||| |||||||||||||| |||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
28871640 |
taaaatatgattttggtccctgcaaatatccttcgttttggttttagtccct-gtaaaaaaaaaattgtt |
28871708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #150
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 40038860 - 40038803
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||| || |||||||||||| |||||| |
|
|
| T |
40038860 |
ttggctaaaatatgattttggtccctgcaaatatgccttgttttggttttaatccctg |
40038803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #151
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 159 - 212
Target Start/End: Complemental strand, 42207570 - 42207518
Alignment:
| Q |
159 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||||||| | |||||||| |||||||||||||||||||||| |
|
|
| T |
42207570 |
ctaaaatatggttttagtcc-tacaaatatgcctcgttttggttttagtccctg |
42207518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #152
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 160 - 212
Target Start/End: Complemental strand, 1287042 - 1286990
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||| ||||||||||||| |||| |
|
|
| T |
1287042 |
taaaatatggttttggtccctgtaaatatgtctcattttggttttagttcctg |
1286990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #153
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 5904008 - 5904063
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||| |||||||||| ||||||||| |||||||||||| |
|
|
| T |
5904008 |
ggctaaaatatggttttgctccttgcaaatatgcctcgttttgattttagtccctg |
5904063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #154
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 28871711 - 28871754
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
28871711 |
ttttggtccctgcaaatatgtctcattttggttttagtccctgg |
28871754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #155
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 161 - 212
Target Start/End: Original strand, 32888691 - 32888742
Alignment:
| Q |
161 |
aaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||| |||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
32888691 |
aaaatatggttttggtccctgcaaatattcctcgttttcgttttagtccctg |
32888742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #156
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 157 - 223
Target Start/End: Complemental strand, 3938119 - 3938053
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaa |
223 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| | |||| |||||| |||||||||||| ||||| |
|
|
| T |
3938119 |
ggctaaaatatgcttttagtccctgcaaatatagcaagtttaggttttggtccctggtaaaaaaaaa |
3938053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #157
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 156 - 226
Target Start/End: Complemental strand, 6894070 - 6894000
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaatt |
226 |
Q |
| |
|
||||||||||||| |||| |||| |||||||||| | |||| |||||| |||||||||||| |||||||| |
|
|
| T |
6894070 |
tggctaaaatatgtttttggtccttgcaaatatgacgagtttaggttttggtccctggtaaaaaaaaaatt |
6894000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #158
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 158 - 208
Target Start/End: Complemental strand, 22551318 - 22551268
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||| | ||||||||||||||| |
|
|
| T |
22551318 |
gctaaaatatggttttagtctctgtaaatatgttttgttttggttttagtc |
22551268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #159
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 170 - 208
Target Start/End: Original strand, 31602221 - 31602259
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
31602221 |
ttttggtccctgcaaatatgtctcgttttggttttagtc |
31602259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #160
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 157 - 203
Target Start/End: Complemental strand, 38182087 - 38182041
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
203 |
Q |
| |
|
||||||||||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
38182087 |
ggctaaaatatggttttggtttctgcaaatatgtctcgttttggttt |
38182041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #161
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 157 - 203
Target Start/End: Original strand, 38189044 - 38189090
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
203 |
Q |
| |
|
||||||||||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
38189044 |
ggctaaaatatggttttggtttctgcaaatatgtctcgttttggttt |
38189090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #162
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 157 - 203
Target Start/End: Complemental strand, 38209313 - 38209267
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
203 |
Q |
| |
|
||||||||||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
38209313 |
ggctaaaatatggttttggtttctgcaaatatgtctcgttttggttt |
38209267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #163
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 157 - 203
Target Start/End: Original strand, 38216269 - 38216315
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
203 |
Q |
| |
|
||||||||||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
38216269 |
ggctaaaatatggttttggtttctgcaaatatgtctcgttttggttt |
38216315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #164
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 157 - 211
Target Start/End: Complemental strand, 38555083 - 38555030
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccct |
211 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
38555083 |
ggctaaaatatggtttg-gtccctgcaaatatgcctcattttggttttagtccct |
38555030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #165
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 159 - 208
Target Start/End: Complemental strand, 20691094 - 20691045
Alignment:
| Q |
159 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
|||||||||| |||| || |||||||||||| |||||||||||||||||| |
|
|
| T |
20691094 |
ctaaaatatgattttggttcctgcaaatatggctcgttttggttttagtc |
20691045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #166
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 152 - 205
Target Start/End: Original strand, 40038489 - 40038542
Alignment:
| Q |
152 |
aaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
205 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||||||| ||||||||| ||||| |
|
|
| T |
40038489 |
aaataggctaaaatatggttttgatccctgcaaatatgcctcgttttgatttta |
40038542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #167
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 157 - 201
Target Start/End: Original strand, 4736205 - 4736249
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggt |
201 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
4736205 |
ggctaaaatatggttttggtctttgcaaatatgtctcgttttggt |
4736249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #168
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 144 - 212
Target Start/End: Original strand, 29855600 - 29855668
Alignment:
| Q |
144 |
catattttaaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||| || ||||||||||| |||| |||| || ||||||| ||| |||||||||||||||||| |
|
|
| T |
29855600 |
catattttattttagctaaaatatgattttggtccttggaaatatgcctcattttggttttagtccctg |
29855668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #169
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 36278081 - 36278133
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| || |||| |||||||||| |
|
|
| T |
36278081 |
ggctaaaatatggttttgatccctgcaaatatgtttcattttagttttagtcc |
36278133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #170
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 157 - 208
Target Start/End: Original strand, 38554751 - 38554800
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
38554751 |
ggctaaaatatggttttgatccctgcaaata--tctcgttttggttttagtc |
38554800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #171
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Complemental strand, 1381538 - 1381495
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
1381538 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgg |
1381495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #172
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 6912571 - 6912614
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
6912571 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgg |
6912614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #173
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 10830529 - 10830584
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||| || |||||||| || |||||||||||||| |||| |
|
|
| T |
10830529 |
ggctaaaatatggttttggtctcttcaaatatgcctagttttggttttagttcctg |
10830584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #174
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Complemental strand, 19565758 - 19565715
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
19565758 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgg |
19565715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #175
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 24443453 - 24443496
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
24443453 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgg |
24443496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #176
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 35876761 - 35876804
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
35876761 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgg |
35876804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #177
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 35928137 - 35928180
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
35928137 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgg |
35928180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #178
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 40764488 - 40764531
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
40764488 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgg |
40764531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #179
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 42596453 - 42596508
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| |||| |||||||| ||| |||||||||||||| |||| |
|
|
| T |
42596453 |
ggctaaaatatggttttgatcccagcaaatatatcttgttttggttttagttcctg |
42596508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #180
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 159 - 209
Target Start/End: Original strand, 22550960 - 22551010
Alignment:
| Q |
159 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
|||||||||||||||||| | || |||||||||||||||| ||||| |||| |
|
|
| T |
22550960 |
ctaaaatatggttttagtacatgtaaatatgtctcgttttagtttttgtcc |
22551010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #181
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 157 - 207
Target Start/End: Complemental strand, 31602515 - 31602465
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
207 |
Q |
| |
|
||||||||||| |||||||| | | |||||||||||||||||| ||||||| |
|
|
| T |
31602515 |
ggctaaaatatagttttagttcatacaaatatgtctcgttttgattttagt |
31602465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #182
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 170 - 212
Target Start/End: Complemental strand, 37271633 - 37271591
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
37271633 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
37271591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #183
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 157 - 229
Target Start/End: Complemental strand, 10830897 - 10830825
Alignment:
| Q |
157 |
ggctaaaatatggttttag-tccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtt |
229 |
Q |
| |
|
|||||||||||| |||| | |||||||||||||| || ||||||||||||||| | ||||| ||||||||||| |
|
|
| T |
10830897 |
ggctaaaatatgatttttggtccctgcaaatatgccttattttggttttagtcctttgtaaa-aaaaaattgtt |
10830825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #184
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 156 - 185
Target Start/End: Original strand, 35165936 - 35165965
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaa |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
35165936 |
tggctaaaatatggttttagtccctgcaaa |
35165965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #185
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 157 - 217
Target Start/End: Original strand, 3936578 - 3936638
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaa |
217 |
Q |
| |
|
|||||||||||| |||| |||||||||||||| | |||| |||||| |||||||||||| |
|
|
| T |
3936578 |
ggctaaaatatgtttttggtccctgcaaatatagcgagtttgggttttggtccctggtaaa |
3936638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #186
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 159 - 227
Target Start/End: Complemental strand, 6244439 - 6244371
Alignment:
| Q |
159 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattg |
227 |
Q |
| |
|
|||||||||| |||| ||||||||||||||| ||| ||| | | || | |||||||||| ||||||||| |
|
|
| T |
6244439 |
ctaaaatatgattttggtccctgcaaatatgactcatttggatattggaccctggtaaaaaaaaaattg |
6244371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #187
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 6953949 - 6954001
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
|||||||||||||||||| || || ||||||| ||| |||||| ||||||||| |
|
|
| T |
6953949 |
ggctaaaatatggttttaatcactacaaatatttcttgttttgattttagtcc |
6954001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #188
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 180 - 212
Target Start/End: Complemental strand, 32109074 - 32109042
Alignment:
| Q |
180 |
tgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
32109074 |
tgcaaatatgtttcgttttggttttagtccctg |
32109042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0811 (Bit Score: 71; Significance: 6e-32; HSPs: 2)
Name: scaffold0811
Description:
Target: scaffold0811; HSP #1
Raw Score: 71; E-Value: 6e-32
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 1311 - 1393
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt-aaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
1311 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaaaaaaaaaattgtttttggtccc |
1393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0811; HSP #2
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 1644 - 1562
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt-aaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| |||||||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
1644 |
ggctaaaatatgaatttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaaattgtttttggtccc |
1562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 70; Significance: 2e-31; HSPs: 216)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 1526172 - 1526091
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
1526172 |
ggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtccctggtaaaaaaataattgtttttggtccc |
1526091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 69; E-Value: 9e-31
Query Start/End: Original strand, 157 - 237
Target Start/End: Original strand, 14238751 - 14238831
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtcc |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
14238751 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtgaaaaaaaaaattgtttttggtcc |
14238831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 8094479 - 8094561
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaatt-gtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
8094479 |
ggctaaaatatggttttagtctctgcaaatatgtctcgttttggttttagtccctggtaaaaaaaaaattcgtttttggtccc |
8094561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 152 - 238
Target Start/End: Original strand, 19494114 - 19494200
Alignment:
| Q |
152 |
aaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||| | |||||||||||||| |
|
|
| T |
19494114 |
aaataggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctggtaaaaaaatatttgtttttggtccc |
19494200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 14239080 - 14238999
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
14239080 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtgaaaaaaaaaattgtttttggtccc |
14238999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 16643661 - 16643742
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
16643661 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctggtaaaaaaaaatttgtttttggtccc |
16643742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 38930302 - 38930383
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||| ||||| |||||||||||||| |
|
|
| T |
38930302 |
ggctaaaatatggttttagtccctgtaaatatgtctcgttttggttttagttcctggtaaaaaaaaatttgtttttggtccc |
38930383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 156 - 239
Target Start/End: Complemental strand, 16789370 - 16789288
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccca |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| ||||| ||||||||||||||| |
|
|
| T |
16789370 |
tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct-gtaaaaaaaaatttgtttttggtccca |
16789288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 155 - 237
Target Start/End: Complemental strand, 14489075 - 14488995
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtcc |
237 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
14489075 |
ttggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct-gtaaa-aaaaaattgtttttggtcc |
14488995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 155 - 237
Target Start/End: Original strand, 15719654 - 15719736
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtcc |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||| | ||| ||||||||||||||||||| |
|
|
| T |
15719654 |
ttggctaaaatatggttttagtccctgcaaatatatctcgttttggttttagtcccggtaaaaaaaaaaattgtttttggtcc |
15719736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 14495069 - 14495150
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||| |||| ||| |||||||||||||||||||| |
|
|
| T |
14495069 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtaaaaaaaaaaattgtttttggtccc |
14495150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 29488110 - 29488030
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
29488110 |
ggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccct-gtaaaaaaaaaattgtttttggtccc |
29488030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 32418318 - 32418398
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||| ||| ||||| |||||||||||||||||||| |
|
|
| T |
32418318 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt-ccttgtaaaaaaaaaattgtttttggtccc |
32418398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 22917564 - 22917647
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt--aaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||| ||||||||| |||||||||| |
|
|
| T |
22917564 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaaaattgattttggtccc |
22917647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 157 - 237
Target Start/End: Complemental strand, 24955010 - 24954931
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtcc |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| |||||||| |||||||||| |
|
|
| T |
24955010 |
ggctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctagtaaa-aaaaaattatttttggtcc |
24954931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 146 - 238
Target Start/End: Original strand, 29487739 - 29487830
Alignment:
| Q |
146 |
tattttaaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||||||||||| |||||||||||||||||| | || || |||||||||||||||||||| |
|
|
| T |
29487739 |
tattttaaattggctaaaatatgattttcgtccctgcaaatatgtttcgttttggttttagtccat-gtgaaaaaaaaattgtttttggtccc |
29487830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 156 - 238
Target Start/End: Original strand, 1162908 - 1162991
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaa-ttgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
1162908 |
tggctaaaatatggttttagtccctgcaaatatgcttcgttttgattttagtccctggtaaaaaaaaaatttgtttttggtccc |
1162991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 155 - 238
Target Start/End: Original strand, 40844154 - 40844235
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
40844154 |
ttggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccct-gtaaa-aaaaaattgtttttggtccc |
40844235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 1525809 - 1525891
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaa-ttgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| ||| |||||| |||||||||||||| |
|
|
| T |
1525809 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtctctggcaaaaaaaaaatttgtttttggtccc |
1525891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 156 - 238
Target Start/End: Original strand, 4375691 - 4375771
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| ||||| |||||||||||||||||||| |
|
|
| T |
4375691 |
tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttattccct-gtaaa-aaaaaattgtttttggtccc |
4375771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 16644044 - 16643962
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt-aaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||| |||| |||||||||||||| |
|
|
| T |
16644044 |
ggctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctggtaaaacaaaattttgtttttggtccc |
16643962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 155 - 237
Target Start/End: Complemental strand, 29158671 - 29158590
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtcc |
237 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |||||||||||||||||| ||| ||||| ||||||||||||||||||| |
|
|
| T |
29158671 |
ttggctaaaatatggttttaatccctgcaaatatatctcgttttggttttagt-ccttgtaaaaaaaaaattgtttttggtcc |
29158590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 38930664 - 38930582
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaa-ttgtttttggtccc |
238 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||||||||| ||||||||||| |||||| |||||||||||||| |
|
|
| T |
38930664 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttaatccctggtaaaaaaaaaatttgtttttggtccc |
38930582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 43477163 - 43477245
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg-gtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
43477163 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaaaattgtttttggtccc |
43477245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 160 - 236
Target Start/End: Original strand, 1685117 - 1685194
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaa-ttgtttttggtc |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||| |||||| |||||||||||| |
|
|
| T |
1685117 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttggtaaaaaaaaaatttgtttttggtc |
1685194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 157 - 222
Target Start/End: Complemental strand, 19494413 - 19494348
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaa |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
19494413 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaa |
19494348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 25131111 - 25131191
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||| |||| |||| |||||||||| |
|
|
| T |
25131111 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcct-gtaaaaaaaatattgattttggtccc |
25131191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 158 - 238
Target Start/End: Original strand, 6146517 - 6146596
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||||||| ||| ||||| |||||||||||||||||||| |
|
|
| T |
6146517 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagt-ccttgtaaaaaaaaaattgtttttggtccc |
6146596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 155 - 238
Target Start/End: Complemental strand, 1163276 - 1163193
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| | |||||| ||||||||| |||||||| ||||| |||||||||||||| |
|
|
| T |
1163276 |
ttggctaaaatatggttttagtccatgcaaatatgccccgttttagttttagtcgctggtaaaaaaaaatttgtttttggtccc |
1163193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 153 - 212
Target Start/End: Original strand, 1778560 - 1778619
Alignment:
| Q |
153 |
aattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1778560 |
aattggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
1778619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 157 - 235
Target Start/End: Complemental strand, 8094841 - 8094762
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaa-ttgtttttggt |
235 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |||||||||||||||||||| |||||| |||||| ||||||||||| |
|
|
| T |
8094841 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccccggtaaaaaaaaaatttgtttttggt |
8094762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 155 - 238
Target Start/End: Complemental strand, 25131449 - 25131366
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| ||||||||||||||||||||| ||| |||| ||||||||||||||| |
|
|
| T |
25131449 |
ttggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctctaaaaaaaaatattgtttttggtccc |
25131366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 29158354 - 29158409
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29158354 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
29158409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 152 - 238
Target Start/End: Original strand, 33636317 - 33636404
Alignment:
| Q |
152 |
aaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaa-attgtttttggtccc |
238 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||| ||||| |||||||||||||| |
|
|
| T |
33636317 |
aaataggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccccggtaaaaaaaaattttgtttttggtccc |
33636404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 155 - 238
Target Start/End: Complemental strand, 40066822 - 40066741
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | ||||||||||||||||||| ||||| ||||| |||||||||||||| |
|
|
| T |
40066822 |
ttggctaaaatatggttttagtccctgcaaatatgccccgttttggttttagtccct-gtaaa-aaaaatttgtttttggtccc |
40066741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 156 - 238
Target Start/End: Original strand, 1408004 - 1408085
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| ||||||| ||| ||||| |||||||||||||||||||| |
|
|
| T |
1408004 |
tggctaaaatatggttttagtccatgcaaatatgtctcgttttagttttagctcct-gtaaaaaaaaaattgtttttggtccc |
1408085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 153 - 238
Target Start/End: Complemental strand, 10776503 - 10776417
Alignment:
| Q |
153 |
aattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg-gtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||| ||| |||||||||||||| ||||| |
|
|
| T |
10776503 |
aattggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtaaaaaaaaaaaattgttttttgtccc |
10776417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 159 - 237
Target Start/End: Complemental strand, 18549571 - 18549495
Alignment:
| Q |
159 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtcc |
237 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||| |||||| |||||||||||| |
|
|
| T |
18549571 |
ctaaaatatggttttcgtccctgcaaatatgtctcgttttggttttagtccct-gtaaa-aaaaaaatgtttttggtcc |
18549495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 1408353 - 1408273
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||| |||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
1408353 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttagttttagtccct-ataaaaaaaaaattgtttttggtccc |
1408273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 158 - 238
Target Start/End: Complemental strand, 6146948 - 6146867
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaa-attgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
6146948 |
gctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctgtaaaataaaaattttgtttttggtccc |
6146867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 7186006 - 7185949
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7186006 |
ttggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
7185949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 21125719 - 21125799
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| ||||||||||||||| ||||| ||| | |||||||||||||||||||| |
|
|
| T |
21125719 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttaatccct-gtataaaaaaaattgtttttggtccc |
21125799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 34963666 - 34963609
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34963666 |
ttggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
34963609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 160 - 237
Target Start/End: Complemental strand, 40844532 - 40844456
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtcc |
237 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||| || || ||||||||||||| |
|
|
| T |
40844532 |
taaaatatggttttagtccctgcaaatatatctcgttttggttttagtccct-gtaaaaaataatttgtttttggtcc |
40844456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 42133156 - 42133099
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42133156 |
ttggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
42133099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 7272420 - 7272502
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaa--ttgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||| | |||| |||||||||||||| |
|
|
| T |
7272420 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtctct-gtaaaaagaaaattttgtttttggtccc |
7272502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 156 - 212
Target Start/End: Original strand, 8298586 - 8298642
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8298586 |
tggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
8298642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 157 - 229
Target Start/End: Original strand, 10337119 - 10337189
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtt |
229 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
10337119 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct-gtaaa-aaaaaattgtt |
10337189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 22650464 - 22650548
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaa----attgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||| ||||| ||||||||||||||| |
|
|
| T |
22650464 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccct-gtaaaaaaaaataatattgtttttggtccc |
22650548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 152 - 212
Target Start/End: Original strand, 35097323 - 35097383
Alignment:
| Q |
152 |
aaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35097323 |
aaataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35097383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 156 - 212
Target Start/End: Original strand, 35346628 - 35346684
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35346628 |
tggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35346684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 152 - 212
Target Start/End: Complemental strand, 35347003 - 35346943
Alignment:
| Q |
152 |
aaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35347003 |
aaataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35346943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 157 - 237
Target Start/End: Original strand, 40066497 - 40066575
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtcc |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| |||||||| ||| ||||| ||||||||||||||||||| |
|
|
| T |
40066497 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagttcct-gtaaa-aaaaaattgtttttggtcc |
40066575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 3512266 - 3512211
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3512266 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
3512211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 7420230 - 7420285
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7420230 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
7420285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 8298975 - 8298920
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8298975 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
8298920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 11019520 - 11019575
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11019520 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
11019575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 16789075 - 16789130
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
16789075 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
16789130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 24187897 - 24187842
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24187897 |
ggctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtccctg |
24187842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 27341591 - 27341536
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
27341591 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
27341536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 32725907 - 32725962
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32725907 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
32725962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 40492960 - 40493015
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
40492960 |
ggctaaaatatggttttagtacctgcaaatatgtctcgttttggttttagtccctg |
40493015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 33526412 - 33526333
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |||||||||||||||||||||| || |||||| ||||||||||||| |
|
|
| T |
33526412 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtgaa--aaaaaaatgtttttggtccc |
33526333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 152 - 238
Target Start/End: Complemental strand, 35143849 - 35143764
Alignment:
| Q |
152 |
aaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||| |||||||||||||||||| ||| || ||||||| ||||||||||||||||||||| | ||| |||||||||||||||||||| |
|
|
| T |
35143849 |
aaataggctaaaatatggttttaatccgtgtaaatatgcctcgttttggttttagtccct-gaaaaaaaaaaattgtttttggtccc |
35143764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 2728599 - 2728542
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2728599 |
ttggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
2728542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 158 - 238
Target Start/End: Original strand, 4016906 - 4016984
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |||||| || |||||| ||||||||||||| |
|
|
| T |
4016906 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctg--caaaaaaaaaatgtttttggtccc |
4016984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 7272753 - 7272696
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
7272753 |
ttggctaaaatatggttttagcccctgcaaatatgcctcgttttggttttagtccctg |
7272696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 11976373 - 11976454
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| ||| ||| |||||||||||||| |
|
|
| T |
11976373 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaattgttgtttttggtccc |
11976454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 157 - 234
Target Start/End: Original strand, 24187569 - 24187644
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttgg |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
24187569 |
ggctaaaatatggttttaatccctgcaaatatgcttcgttttggttttagtccct-gtaaa-aaaaaattgtttttgg |
24187644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 147 - 212
Target Start/End: Original strand, 25600220 - 25600285
Alignment:
| Q |
147 |
attttaaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||| ||| ||||||||||||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
25600220 |
atttttaataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg |
25600285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 35097694 - 35097637
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
35097694 |
ttggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
35097637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 42132862 - 42132919
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
42132862 |
ttggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttaatccctg |
42132919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 157 - 237
Target Start/End: Complemental strand, 4017300 - 4017221
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtcc |
237 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||||||||||||||||||||| | ||| ||||| |||||||| |||| |
|
|
| T |
4017300 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccct-gcaaaaaaaaatttgttttttgtcc |
4017221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 156 - 212
Target Start/End: Complemental strand, 7326422 - 7326366
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
7326422 |
tggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
7326366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 157 - 229
Target Start/End: Complemental strand, 10540782 - 10540710
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtt |
229 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
10540782 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgtaaaaaaaaaaattgtt |
10540710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 160 - 212
Target Start/End: Complemental strand, 11976733 - 11976681
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11976733 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
11976681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 160 - 212
Target Start/End: Original strand, 13232201 - 13232253
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13232201 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
13232253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 157 - 237
Target Start/End: Original strand, 14488716 - 14488795
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtcc |
237 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||| |||||||||||||||||| || ||||| ||||| ||||||||||||| |
|
|
| T |
14488716 |
ggctaaaatatagttttagtccctgaaaatatgcctcgttttggttttagtctct-gtaaaaaaaaatttgtttttggtcc |
14488795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 157 - 229
Target Start/End: Complemental strand, 20984510 - 20984440
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtt |
229 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
20984510 |
ggctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtccct-gtaaa-aaaaaattgtt |
20984440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 157 - 233
Target Start/End: Complemental strand, 21126021 - 21125945
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttg |
233 |
Q |
| |
|
||||||||||| |||||||||| || ||||||| |||||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
21126021 |
ggctaaaatatagttttagtccatgtaaatatgactcgttttggttttagtccctgtaaaaaaaaaaattgtttttg |
21125945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #81
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 24815068 - 24814986
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaa--attgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||| | ||||||||||||||||| ||||||||||||||||| ||||| ||||| ||||||||||||||| |
|
|
| T |
24815068 |
ggctaaaatatggttttggcccctgcaaatatgtctcattttggttttagtccct-gtaaaaaaaaattattgtttttggtccc |
24814986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #82
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 2728232 - 2728287
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2728232 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtccctg |
2728287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #83
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 4473704 - 4473759
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4473704 |
ggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtccctg |
4473759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #84
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 4710220 - 4710165
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
4710220 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
4710165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #85
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 148 - 211
Target Start/End: Original strand, 5357414 - 5357477
Alignment:
| Q |
148 |
ttttaaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccct |
211 |
Q |
| |
|
|||||||| |||||||||||| |||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
5357414 |
ttttaaataggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccct |
5357477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #86
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 9496341 - 9496396
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
9496341 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg |
9496396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #87
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 154 - 205
Target Start/End: Original strand, 10776145 - 10776196
Alignment:
| Q |
154 |
attggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
205 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10776145 |
attgtctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
10776196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #88
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 11019857 - 11019802
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
11019857 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
11019802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #89
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 17073807 - 17073862
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
17073807 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
17073862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #90
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 17574463 - 17574408
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
17574463 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
17574408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #91
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 20984146 - 20984201
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
20984146 |
ggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg |
20984201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #92
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 28346394 - 28346449
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
28346394 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
28346449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #93
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 28346758 - 28346703
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
28346758 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
28346703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #94
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 28399035 - 28398958
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
28399035 |
ggctaaaatatgattttagtccctgcaaatatggttcgttttggttttagtccct-gta---aaaaaattgtttttggtccc |
28398958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #95
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 32726271 - 32726216
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
32726271 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
32726216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #96
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 34963300 - 34963355
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
34963300 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
34963355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #97
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 37536086 - 37536141
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
37536086 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
37536141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #98
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 157 - 237
Target Start/End: Original strand, 14496816 - 14496893
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtcc |
237 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||||||||||||||| || | ||||||||||||||||||| |
|
|
| T |
14496816 |
ggctaaaatatggttttagttcctgcaaatatgcgtcgttttggttttagtccc---tataaaaaaaattgtttttggtcc |
14496893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #99
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 10873282 - 10873225
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
10873282 |
ttggctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtccctg |
10873225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #100
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 157 - 222
Target Start/End: Original strand, 19962995 - 19963060
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaa |
222 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
19962995 |
ggctaaaatatggtgttagtccttgcaaatatgtctcgttttagttttagtccctgtaaaataaaa |
19963060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #101
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 27117753 - 27117834
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| |||||||||||| ||| ||| |||||||||||||| |
|
|
| T |
27117753 |
ggctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtccctgtaaaaaaaattgttgtttttggtccc |
27117834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #102
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 37536421 - 37536364
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
37536421 |
ttggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
37536364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #103
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 156 - 212
Target Start/End: Complemental strand, 4621355 - 4621299
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
4621355 |
tggctaaaatatagttttggtccctgcaaatatgcctcgttttggttttagtccctg |
4621299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #104
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 13155251 - 13155169
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaa--attgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||||||||||||||| ||||| ||||| ||||| |||||||||| |||| |
|
|
| T |
13155251 |
ggctaaaatatggtttttgttcctgcaaatatgtctcgttttggttttaatccct-gtaaaaaaaaattattgtttttgatccc |
13155169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #105
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 159 - 236
Target Start/End: Original strand, 13779151 - 13779229
Alignment:
| Q |
159 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaa--ttgtttttggtc |
236 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||| ||||| ||||| |||||| |||||||||||| |
|
|
| T |
13779151 |
ctaaaatatggttttgatccctgcaaatatgtctcgttttggttttattccct-gtaaaaaaaaaatgttgtttttggtc |
13779229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #106
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 157 - 229
Target Start/End: Complemental strand, 25600597 - 25600527
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtt |
229 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||| |||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
25600597 |
ggctaaaatatagttttggtccctgcaaatatgtcttgttttggttttagtccct-gtaaa-aaaaaattgtt |
25600527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #107
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 157 - 237
Target Start/End: Complemental strand, 35345617 - 35345537
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtcc |
237 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||||||||||| |||||| ||| ||| ||||||||||||| |
|
|
| T |
35345617 |
ggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttaatccctgtaaaaaaaacttttgtttttggtcc |
35345537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #108
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 42430120 - 42430068
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
42430120 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
42430068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #109
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 3511906 - 3511961
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| |||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
3511906 |
ggctaaaatatggttttggtcccttcaaatatgcctcgttttggttttagtccctg |
3511961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #110
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 4474044 - 4473989
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
4474044 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctg |
4473989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #111
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 7326086 - 7326141
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
7326086 |
ggctaaaatatggttttggtccttgcaaatatgcctcgttttggttttagtccctg |
7326141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #112
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 7420590 - 7420535
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
7420590 |
ggctaaaatatggttttggtcactgcaaatatgcctcgttttggttttagtccctg |
7420535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #113
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 9175012 - 9175067
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||| |||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
9175012 |
ggctaaaatatgattttggtccttgcaaatatgtctcgttttggttttagtccctg |
9175067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #114
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 9496723 - 9496668
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
9496723 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
9496668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #115
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 10337449 - 10337394
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
10337449 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctg |
10337394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #116
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 10872915 - 10872970
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
10872915 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctg |
10872970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #117
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 208
Target Start/End: Original strand, 18549201 - 18549252
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
18549201 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtc |
18549252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #118
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 20277692 - 20277747
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
20277692 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctg |
20277747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #119
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 21064319 - 21064374
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
21064319 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctg |
21064374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #120
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 145 - 207
Target Start/End: Original strand, 23939534 - 23939597
Alignment:
| Q |
145 |
atatttta-aattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
207 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||| |||||||||||||||||||| |||||||| |
|
|
| T |
23939534 |
atattttataattggctaaaatatggttttggtcactgcaaatatgtctcgttttagttttagt |
23939597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #121
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 158 - 229
Target Start/End: Complemental strand, 24090487 - 24090418
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtt |
229 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||||||||||||| || ||||| ||||||||||| |
|
|
| T |
24090487 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtctct-gtaaa-aaaaaattgtt |
24090418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #122
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 28324181 - 28324126
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
28324181 |
ggctaaaatatggttttggtccctacaaatatgtcttgttttggttttagtccctg |
28324126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #123
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 32040075 - 32040130
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||| | ||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
32040075 |
ggctaaaatatgatcttagtccctgcaaatatgtttcgttttggttttagtccctg |
32040130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #124
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 157 - 211
Target Start/End: Complemental strand, 10755528 - 10755474
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccct |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||| ||||| ||||| |
|
|
| T |
10755528 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttaatccct |
10755474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #125
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 158 - 237
Target Start/End: Complemental strand, 14495389 - 14495313
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtcc |
237 |
Q |
| |
|
||||||||||||| |||||||| ||||||||| |||||||||||||||||||| | | ||||||||||||||||||| |
|
|
| T |
14495389 |
gctaaaatatggtnttagtccccgcaaatatgcctcgttttggttttagtccc---cataaaaaaaattgtttttggtcc |
14495313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #126
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 157 - 211
Target Start/End: Original strand, 28323849 - 28323903
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccct |
211 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
28323849 |
ggctaaaatatggttgtagtccctgcaaatatgcttcgttttggttttagtccct |
28323903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #127
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 157 - 203
Target Start/End: Complemental strand, 30337217 - 30337171
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
203 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
30337217 |
ggctaaaatatagttttagtccctgcaaatatgtctcgttttggttt |
30337171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #128
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 159 - 209
Target Start/End: Complemental strand, 43727431 - 43727382
Alignment:
| Q |
159 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
43727431 |
ctaaaatatggttttagtcc-tgcaaatatgtctcgttttggttttagtcc |
43727382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #129
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 154 - 227
Target Start/End: Complemental strand, 3031605 - 3031532
Alignment:
| Q |
154 |
attggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattg |
227 |
Q |
| |
|
||||||||||||||| |||| ||||||| ||||||| ||| ||| |||||| |||||||||||| ||||||||| |
|
|
| T |
3031605 |
attggctaaaatatgtttttggtccctgtaaatatggctcatttaggttttggtccctggtaaaaaaaaaattg |
3031532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #130
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 156 - 209
Target Start/End: Original strand, 33526051 - 33526104
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
33526051 |
tggctaaaatatggttttagtccctgcaaatatgcttcgctttggttttagtcc |
33526104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #131
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 160 - 208
Target Start/End: Complemental strand, 2811778 - 2811730
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
2811778 |
taaaatatggttttgatccctgcaaatatgtctcgttttggttttagtc |
2811730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #132
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 157 - 229
Target Start/End: Original strand, 6469280 - 6469350
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtt |
229 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||| ||||||||||||||||| ||| ||||| ||||||||||| |
|
|
| T |
6469280 |
ggctaaaatatggctttcgtccctgcaaatatgcctcgttttggttttagttcct-gtaaa-aaaaaattgtt |
6469350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #133
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 20278057 - 20278005
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
||||||||||||||||| ||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
20278057 |
ggctaaaatatggttttggtccctgcagatatgcctcgttttggttttagtcc |
20278005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #134
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 21064684 - 21064632
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
||||||||||||||||| ||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
21064684 |
ggctaaaatatggttttggtccctgcagatatgcctcgttttggttttagtcc |
21064632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #135
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 157 - 237
Target Start/End: Original strand, 26530668 - 26530746
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtcc |
237 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||| ||| |||| |||||||| ||| ||||| ||||||||||||||||||| |
|
|
| T |
26530668 |
ggcttaaatatggttttagtccatgcaaatatgcctcattttagttttagttcct-gtaaa-aaaaaattgtttttggtcc |
26530746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #136
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 28258241 - 28258189
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
28258241 |
ggctaaaatatggttttaacctctgcaaatatgtctcgttttggttttagtcc |
28258189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #137
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 160 - 212
Target Start/End: Complemental strand, 28497616 - 28497564
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||| |||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
28497616 |
taaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
28497564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #138
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 157 - 229
Target Start/End: Complemental strand, 29992300 - 29992229
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtt |
229 |
Q |
| |
|
|||| |||||||||||| |||||||||||||| ||||||||| ||||||||||| ||||| ||||||||||| |
|
|
| T |
29992300 |
ggctcaaatatggttttgttccctgcaaatatgcctcgttttgattttagtccct-gtaaaaaaaaaattgtt |
29992229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #139
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 156 - 207
Target Start/End: Complemental strand, 13232563 - 13232512
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
207 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||| ||||||||||||| |
|
|
| T |
13232563 |
tggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagt |
13232512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #140
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 35115639 - 35115584
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| |||||||||||||| ||||||| |
|
|
| T |
35115639 |
ggctaaaatatggttttagtccctacaaatatacctcgttttggttttggtccctg |
35115584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #141
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 158 - 205
Target Start/End: Complemental strand, 36044791 - 36044744
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
205 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
36044791 |
gctaaaatatggttttggtccctgcaaatgtgtctcgttttggtttta |
36044744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #142
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 162 - 212
Target Start/End: Original strand, 3680532 - 3680582
Alignment:
| Q |
162 |
aaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3680532 |
aaatatggttttgctccctgcaaatatgactcgttttggttttagtccctg |
3680582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #143
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 157 - 211
Target Start/End: Original strand, 10540449 - 10540503
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccct |
211 |
Q |
| |
|
||||||||||| ||||| ||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
10540449 |
ggctaaaatattgttttggtctctgcaaatatgcctcgttttggttttagtccct |
10540503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #144
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 158 - 212
Target Start/End: Complemental strand, 13779531 - 13779477
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
13779531 |
gctaaaatatggatttggtccctgcaaatatgcctcgttttggttttagcccctg |
13779477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #145
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 158 - 212
Target Start/End: Original strand, 15930933 - 15930987
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||| |||| || ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
15930933 |
gctaaaatatgattttggttcctacaaatatgtctcgttttggttttagtccctg |
15930987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #146
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 157 - 211
Target Start/End: Complemental strand, 27117976 - 27117922
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccct |
211 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||| |||||| |
|
|
| T |
27117976 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttggtccct |
27117922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #147
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 158 - 212
Target Start/End: Original strand, 30969399 - 30969453
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||| |||| | ||||||||| ||||||||||||||||||||| |
|
|
| T |
30969399 |
gctaaaatatggttttggtccttacaaatatgtttcgttttggttttagtccctg |
30969453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #148
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 156 - 202
Target Start/End: Complemental strand, 40493158 - 40493112
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggtt |
202 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
40493158 |
tggctaaaatgtggttttagtccctgcaaatatgcctcgttttggtt |
40493112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #149
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 159 - 238
Target Start/End: Original strand, 43727097 - 43727178
Alignment:
| Q |
159 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaa--ttgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||| | |||||| ||||||| |||| ||| |||||| |||||||||||||| |
|
|
| T |
43727097 |
ctaaaatatggttttagtccctgcaaatatgcattgttttgattttagttcctgtaaaaaaaaaaaatttgtttttggtccc |
43727178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #150
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 155 - 209
Target Start/End: Complemental strand, 44998265 - 44998211
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
||||||||||||||||||| || || |||||||||||||||||||||||||||| |
|
|
| T |
44998265 |
ttggctaaaatatggttttgatctctacaaatatgtctcgttttggttttagtcc |
44998211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #151
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 158 - 238
Target Start/End: Complemental strand, 7578527 - 7578450
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||| ||||||| | |||||||||||| ||| ||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
7578527 |
gctaaaatacggttttaattcctgcaaatatgactcattttggttttagtcc--tgtaaa-aaaaaattgtttttggtccc |
7578450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #152
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 160 - 208
Target Start/End: Complemental strand, 9175368 - 9175320
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
|||||||||||||| ||||||| ||||||| |||||||||||||||||| |
|
|
| T |
9175368 |
taaaatatggttttggtccctgtaaatatgcctcgttttggttttagtc |
9175320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #153
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 160 - 212
Target Start/End: Complemental strand, 13796593 - 13796541
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
13796593 |
taaaatatggtttggatccctgcaaatatgtctcattttggttttagtccctg |
13796541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #154
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 28497255 - 28497307
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| |||||||| |||||||||| |
|
|
| T |
28497255 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttagttttagtcc |
28497307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #155
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 160 - 237
Target Start/End: Original strand, 29991918 - 29991996
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaa--attgtttttggtcc |
237 |
Q |
| |
|
|||||||||||||| ||| ||||||||||| |||||||| ||||||||| || ||||| ||||| |||||||||||||| |
|
|
| T |
29991918 |
taaaatatggttttggtctctgcaaatatgcctcgttttagttttagtctct-gtaaaaaaaaattattgtttttggtcc |
29991996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #156
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 169 - 212
Target Start/End: Complemental strand, 1778917 - 1778874
Alignment:
| Q |
169 |
gttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
1778917 |
gttttggtccctgcaaatatgtctcgttttggttttaatccctg |
1778874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #157
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 3680801 - 3680746
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||| |||| |||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
3680801 |
ggctaaaatatgattttgatccctgcaaatatgcctcgttttggttttggtccctg |
3680746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #158
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 157 - 208
Target Start/End: Complemental strand, 4376010 - 4375960
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
4376010 |
ggctaaaatatggttttagtccctgcaaatatgcttcg-tttggttttagtc |
4375960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #159
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 6469667 - 6469612
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||| |||| ||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
6469667 |
ggctaaaatatgattttggtcactgcaaatatgttacgttttggttttagtccctg |
6469612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #160
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 13154886 - 13154941
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||| ||||| ||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
13154886 |
ggctaaaatatagttttgatccttgcaaatatgcctcgttttggttttagtccctg |
13154941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #161
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 162 - 209
Target Start/End: Original strand, 24814710 - 24814757
Alignment:
| Q |
162 |
aaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
24814710 |
aaatatggttttggtccctgcaaatatgcctcattttggttttagtcc |
24814757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #162
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 25702512 - 25702567
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||| |||||||| |||||||||||| |
|
|
| T |
25702512 |
ggctaaaatatggttttggtccctgtaaatatgcctcgttttaattttagtccctg |
25702567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #163
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 154 - 189
Target Start/End: Original strand, 28398753 - 28398788
Alignment:
| Q |
154 |
attggctaaaatatggttttagtccctgcaaatatg |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
28398753 |
attggctaaaatatggttttagtccctgcaaatatg |
28398788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #164
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 160 - 207
Target Start/End: Original strand, 33652193 - 33652240
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
207 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
33652193 |
taaaatatgattttagtccctgcaaatatgcctcgttttagttttagt |
33652240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #165
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 158 - 208
Target Start/End: Complemental strand, 5357762 - 5357712
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
||||||||||| |||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
5357762 |
gctaaaatatgattttggtccctgcaaatatgcttcgttttggttttagtc |
5357712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #166
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 157 - 199
Target Start/End: Original strand, 9908918 - 9908960
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttg |
199 |
Q |
| |
|
||||||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
9908918 |
ggctaaaatatagttttaatccctgcaaatatgtctcgttttg |
9908960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #167
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 157 - 227
Target Start/End: Original strand, 10717121 - 10717191
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattg |
227 |
Q |
| |
|
|||||||||||| |||| |||||||||||||| | |||| |||||| |||||||||||| ||||||||| |
|
|
| T |
10717121 |
ggctaaaatatgcttttggtccctgcaaatatagcgagtttgggttttggtccctggtaaaaaaaaaattg |
10717191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #168
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 160 - 210
Target Start/End: Complemental strand, 14848186 - 14848137
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccc |
210 |
Q |
| |
|
||||||||| ||||| ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
14848186 |
taaaatatgattttaatcc-tgcaaatatgtctcgttttggttttagtccc |
14848137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #169
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 170 - 212
Target Start/End: Original strand, 23939620 - 23939662
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
23939620 |
ttttggtccctgcaaatatatctcgttttggttttagtccctg |
23939662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #170
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 155 - 216
Target Start/End: Complemental strand, 4184040 - 4183979
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaa |
216 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| ||||| |||||| ||||||||||| |
|
|
| T |
4184040 |
ttggctaaaatatgcttttagtccctgcaaatatagtgcgtttgggttttggtccctggtaa |
4183979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #171
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 157 - 198
Target Start/End: Complemental strand, 25702809 - 25702768
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgtttt |
198 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
25702809 |
ggctaaaatatggttttggtccctgcaaatatgtctcatttt |
25702768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #172
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 27341258 - 27341337
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||| |||||||||||| || |||||| ||||||| ||| ||||| ||| |||||||||||||||| |
|
|
| T |
27341258 |
ggctaaaatatggttttaactcctgcaaatatgccttgttttgattttagt-ccttgtaaa-aaagaattgtttttggtccc |
27341337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #173
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 155 - 208
Target Start/End: Original strand, 32195278 - 32195331
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||||||| |||| |||||||| |
|
|
| T |
32195278 |
ttggctaaaatatggttttggtccctacaaatatgtctcattttaattttagtc |
32195331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #174
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 180 - 212
Target Start/End: Original strand, 4709929 - 4709961
Alignment:
| Q |
180 |
tgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
4709929 |
tgcaaatatgtctcgttttggttttagtccctg |
4709961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #175
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 148 - 212
Target Start/End: Original strand, 9832206 - 9832270
Alignment:
| Q |
148 |
ttttaaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||| ||||||| ||||||||| |||| ||||||||||| | |||||||||||| |||||| |
|
|
| T |
9832206 |
ttttaaaaaggctaaattatggttttggtccttgcaaatatgttttgttttggttttaatccctg |
9832270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #176
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 160 - 208
Target Start/End: Original strand, 17574105 - 17574153
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| |||||| |||||||| |
|
|
| T |
17574105 |
taaaatatggttttggtccctgcaaatatgtcgggttttgattttagtc |
17574153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #177
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 157 - 205
Target Start/End: Original strand, 44997931 - 44997979
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
205 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||| ||||| |
|
|
| T |
44997931 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttgatttta |
44997979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #178
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Complemental strand, 3512193 - 3512150
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
3512193 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgg |
3512150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #179
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 4709979 - 4710022
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
4709979 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgg |
4710022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #180
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 7326159 - 7326202
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
7326159 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgg |
7326202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #181
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 7420303 - 7420346
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| |||||||| |
|
|
| T |
7420303 |
ttttagtccctgcaaatatgcctcattttggttttggtccctgg |
7420346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #182
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 209
Target Start/End: Complemental strand, 9175298 - 9175259
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
9175298 |
ttttggtccctgcaaatatgtctcgttttggttttggtcc |
9175259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #183
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Complemental strand, 9496650 - 9496607
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
9496650 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgg |
9496607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #184
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 11019593 - 11019636
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
11019593 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgg |
11019636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #185
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Complemental strand, 11976663 - 11976620
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
11976663 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgg |
11976620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #186
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 13232271 - 13232314
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| |||||||| |
|
|
| T |
13232271 |
ttttagtccctgcaaatatgcctcattttggttttggtccctgg |
13232314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #187
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 209
Target Start/End: Complemental strand, 13779462 - 13779423
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
13779462 |
ttttggtccctgcaaatatgtctcgttttggttttggtcc |
13779423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #188
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 160 - 211
Target Start/End: Original strand, 14847828 - 14847879
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccct |
211 |
Q |
| |
|
||||||||| |||| |||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
14847828 |
taaaatatgattttgatccctgcaaatatgcctcattttggttttagtccct |
14847879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #189
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 161 - 208
Target Start/End: Complemental strand, 17074164 - 17074117
Alignment:
| Q |
161 |
aaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
||||||||||||| ||||||||||||||||| |||||| |||||||| |
|
|
| T |
17074164 |
aaaatatggttttggtccctgcaaatatgtcgggttttgattttagtc |
17074117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #190
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 20277765 - 20277808
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
20277765 |
ttttagtccctgcaaatatgcttcgttttggttttggtccctgg |
20277808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #191
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 21064392 - 21064435
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
21064392 |
ttttagtccctgcaaatatgcttcgttttggttttggtccctgg |
21064435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #192
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 183 - 226
Target Start/End: Original strand, 24954697 - 24954740
Alignment:
| Q |
183 |
aaatatgtctcgttttggttttagtccctggtaaataaaaaatt |
226 |
Q |
| |
|
||||||| ||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
24954697 |
aaatatgcctcgttttggttttagttcctggtaaaaaaaaaatt |
24954740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #193
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Complemental strand, 28346685 - 28346642
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
28346685 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgg |
28346642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #194
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 34963373 - 34963416
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
34963373 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgg |
34963416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #195
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Complemental strand, 35097619 - 35097576
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
35097619 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgg |
35097576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #196
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Complemental strand, 37536346 - 37536303
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
37536346 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgg |
37536303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #197
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 42429758 - 42429812
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| |||||| |||||||| ||| ||||||||||||||||| |
|
|
| T |
42429758 |
ggctaaaatatggttttggtccctacaaatatgcctc-atttggttttagtccctg |
42429812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #198
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 213
Target Start/End: Complemental strand, 42430047 - 42430004
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
213 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
42430047 |
tttttgtccctgcaaatatgcctcgttttggttttggtccctgg |
42430004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #199
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 170 - 212
Target Start/End: Complemental strand, 2728524 - 2728482
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
2728524 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
2728482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #200
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 157 - 227
Target Start/End: Original strand, 14197825 - 14197895
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattg |
227 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| | |||| | |||| |||||| ||||| ||||||||| |
|
|
| T |
14197825 |
ggctaaaatatgtttttggtccctgcaaatatggcgagtttggattttggtccctagtaaaaaaaaaattg |
14197895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #201
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 170 - 212
Target Start/End: Original strand, 20984219 - 20984261
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
20984219 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
20984261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #202
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 157 - 211
Target Start/End: Original strand, 24090119 - 24090173
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccct |
211 |
Q |
| |
|
||||||||||||||||| || | || | ||||||||||||||| ||||||||||| |
|
|
| T |
24090119 |
ggctaaaatatggttttggttcttgtagatatgtctcgttttgattttagtccct |
24090173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #203
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 170 - 212
Target Start/End: Complemental strand, 36044718 - 36044676
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||| ||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
36044718 |
ttttaatccctgcaaatatatctcgttttggttttggtccctg |
36044676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #204
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 148 - 226
Target Start/End: Complemental strand, 36589455 - 36589377
Alignment:
| Q |
148 |
ttttaaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaatt |
226 |
Q |
| |
|
||||||| |||||||||||| ||||||| ||||||||||| | |||| |||||| |||| ||||||| |||||||| |
|
|
| T |
36589455 |
ttttaaaaaggctaaaatatgattttagttcctgcaaatatagcgagtttaggttttggtccttggtaaaaaaaaaatt |
36589377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #205
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 157 - 223
Target Start/End: Original strand, 39439924 - 39439990
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaa |
223 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| || |||| ||||| | |||||||||| ||||| |
|
|
| T |
39439924 |
ggctaaaatatgattttggtccctgcaaatatggctagtttgagttttggaccctggtaaaaaaaaa |
39439990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #206
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 157 - 226
Target Start/End: Complemental strand, 15719979 - 15719911
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaatt |
226 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||| |||||||||||| | ||| ||||| |||||||| |
|
|
| T |
15719979 |
ggctaaaatataattttagtttctgcaaatatgtcttgttttggttttaat-ccttgtaaaaaaaaaatt |
15719911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #207
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 159 - 192
Target Start/End: Original strand, 16010596 - 16010629
Alignment:
| Q |
159 |
ctaaaatatggttttagtccctgcaaatatgtct |
192 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
16010596 |
ctaaaatattgttttagtccctgcaaatatgtct |
16010629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #208
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 164 - 209
Target Start/End: Original strand, 23360378 - 23360423
Alignment:
| Q |
164 |
atatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
|||||||||| ||| |||||||||||||||||||| ||||||||| |
|
|
| T |
23360378 |
atatggttttggtctctgcaaatatgtctcgttttaattttagtcc |
23360423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #209
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 160 - 209
Target Start/End: Complemental strand, 23939907 - 23939858
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
|||||||||||||| | |||||||||||| |||||||||| |||||||| |
|
|
| T |
23939907 |
taaaatatggttttgattcctgcaaatatgactcgttttggctttagtcc |
23939858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #210
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 178 - 211
Target Start/End: Original strand, 24090200 - 24090233
Alignment:
| Q |
178 |
cctgcaaatatgtctcgttttggttttagtccct |
211 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |
|
|
| T |
24090200 |
cctgcaaatatgtctcgttttggttttcgtccct |
24090233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #211
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 156 - 189
Target Start/End: Complemental strand, 30969718 - 30969685
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatg |
189 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |
|
|
| T |
30969718 |
tggctaaaatatggttttggtccctgcaaatatg |
30969685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #212
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 157 - 226
Target Start/End: Original strand, 36588222 - 36588291
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaatt |
226 |
Q |
| |
|
|||||||||||| |||| |||||||||||||| | |||| ||||| |||||||||||| |||||||| |
|
|
| T |
36588222 |
ggctaaaatatgcttttggtccctgcaaatatagcgagtttgcgttttggtccctggtaaaaaaaaaatt |
36588291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #213
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 157 - 226
Target Start/End: Complemental strand, 38456789 - 38456720
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaatt |
226 |
Q |
| |
|
|||||||||||| |||| |||||||||||||| | ||| |||||| |||||||||||| |||||||| |
|
|
| T |
38456789 |
ggctaaaatatgcttttggtccctgcaaatatagcaaatttaggttttggtccctggtaaaaaaaaaatt |
38456720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #214
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 180 - 208
Target Start/End: Complemental strand, 2356225 - 2356197
Alignment:
| Q |
180 |
tgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
2356225 |
tgcaaatatgtctcgttttggttttagtc |
2356197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #215
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 157 - 189
Target Start/End: Complemental strand, 21509918 - 21509886
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatg |
189 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
21509918 |
ggctaaaatatgattttagtccctgcaaatatg |
21509886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #216
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 198 - 237
Target Start/End: Complemental strand, 22917887 - 22917847
Alignment:
| Q |
198 |
tggttttagtccctggt-aaataaaaaattgtttttggtcc |
237 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
22917887 |
tggttttagtccctggtaaaaaaaaaaattgtttttggtcc |
22917847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0337 (Bit Score: 67; Significance: 1e-29; HSPs: 1)
Name: scaffold0337
Description:
Target: scaffold0337; HSP #1
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 156 - 238
Target Start/End: Original strand, 12524 - 12606
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||| |||||||||||||||||||| |
|
|
| T |
12524 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttgtaaaaaaaaaaattgtttttggtccc |
12606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0210 (Bit Score: 66; Significance: 6e-29; HSPs: 2)
Name: scaffold0210
Description:
Target: scaffold0210; HSP #1
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 15012 - 14932
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
15012 |
ggctaaaatatggttttagtccctgcaaatatgtctcattttggttttagtccct-gtaaaaaaaaaattgtttttggtccc |
14932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0210; HSP #2
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 157 - 231
Target Start/End: Original strand, 14697 - 14771
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttt |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
14697 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtgaaaaaaaaaattgtttt |
14771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0051 (Bit Score: 65; Significance: 2e-28; HSPs: 2)
Name: scaffold0051
Description:
Target: scaffold0051; HSP #1
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 5708 - 5625
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaa--ttgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
5708 |
ggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtccctggtaaaaaaaaaaatttgtttttggtccc |
5625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0051; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 157 - 236
Target Start/End: Original strand, 5399 - 5478
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtc |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || ||||||||||||||| |||||||| ||||| |||||||||||| |
|
|
| T |
5399 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtctctggtaaaaaaaaatttgtttttggtc |
5478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0373 (Bit Score: 63; Significance: 3e-27; HSPs: 1)
Name: scaffold0373
Description:
Target: scaffold0373; HSP #1
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 8547 - 8629
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaa-ttgtttttggtccc |
238 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
8547 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaatttgtttttggtccc |
8629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0065 (Bit Score: 63; Significance: 3e-27; HSPs: 2)
Name: scaffold0065
Description:
Target: scaffold0065; HSP #1
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 156 - 238
Target Start/End: Original strand, 3531 - 3611
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||| |||||||||||||||||||| |
|
|
| T |
3531 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt-ccttgtaaa-aaaaaattgtttttggtccc |
3611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0065; HSP #2
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 3918 - 3863
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
3918 |
ggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctg |
3863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1001 (Bit Score: 62; Significance: 1e-26; HSPs: 1)
Name: scaffold1001
Description:
Target: scaffold1001; HSP #1
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 2778 - 2857
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
2778 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct-gtaaa-aaaaaattgtttttggtccc |
2857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179 (Bit Score: 59; Significance: 8e-25; HSPs: 1)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 157 - 235
Target Start/End: Complemental strand, 3291 - 3214
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggt |
235 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||| ||||| ||||||||||| |
|
|
| T |
3291 |
ggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccct-gtaaaaaaaaatttgtttttggt |
3214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0166 (Bit Score: 59; Significance: 8e-25; HSPs: 2)
Name: scaffold0166
Description:
Target: scaffold0166; HSP #1
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 24372 - 24454
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt-aaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||| | ||| ||||| |||||||||||||| |
|
|
| T |
24372 |
ggctaaaatatggttttagtcactgcaaatatgtctcgttttggttttagtccctgttaaaagaaaaatttgtttttggtccc |
24454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0166; HSP #2
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 24657 - 24578
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||| ||||||||| | |||||||| ||||||||| ||||||||||| ||||| || ||||||||||||||||| |
|
|
| T |
24657 |
ggctaaaatataattttagtcc-tacaaatatgcctcgttttgattttagtccct-gtaaaaaataaattgtttttggtccc |
24578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 59; Significance: 8e-25; HSPs: 2)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 366273 - 366195
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
366273 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct-gtaa--aaaaaattgtttttggtccc |
366195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003; HSP #2
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 365979 - 366034
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
365979 |
ggctaaaatatggttttaatccttgcaaatatgcctcgttttggttttagtccctg |
366034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0159 (Bit Score: 57; Significance: 1e-23; HSPs: 1)
Name: scaffold0159
Description:
Target: scaffold0159; HSP #1
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 146 - 218
Target Start/End: Original strand, 34920 - 34992
Alignment:
| Q |
146 |
tattttaaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaat |
218 |
Q |
| |
|
|||| |||| ||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
34920 |
tattataaaatggctaaaatatggtcttagtccctgcaaatatgcctcgttttggttttagtccctggtaaat |
34992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060 (Bit Score: 56; Significance: 5e-23; HSPs: 2)
Name: scaffold0060
Description:
Target: scaffold0060; HSP #1
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 147 - 237
Target Start/End: Original strand, 8320 - 8411
Alignment:
| Q |
147 |
attttaaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg-gtaaataaaaaattgtttttggtcc |
237 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||| || ||| ||||||||||||||||||| |
|
|
| T |
8320 |
attttaaaaaggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccttgtaaaaaaaaaaaattgtttttggtcc |
8411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060; HSP #2
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 8642 - 8590
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
8642 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtcc |
8590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021 (Bit Score: 55; Significance: 2e-22; HSPs: 2)
Name: scaffold0021
Description:
Target: scaffold0021; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 12182 - 12264
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaa-attgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
12182 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagtccctgtaaaataaaaattttgtttttggtccc |
12264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021; HSP #2
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 156 - 237
Target Start/End: Complemental strand, 12537 - 12455
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaa-ttgtttttggtcc |
237 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||||||||||||||||||| || ||| |||||| ||||||||||||| |
|
|
| T |
12537 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccttgtaaaaaaaaaaatttgtttttggtcc |
12455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0535 (Bit Score: 54; Significance: 8e-22; HSPs: 2)
Name: scaffold0535
Description:
Target: scaffold0535; HSP #1
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 152 - 238
Target Start/End: Complemental strand, 9033 - 8946
Alignment:
| Q |
152 |
aaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaa--attgtttttggtccc |
238 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| ||||| |||||||||||||| |
|
|
| T |
9033 |
aaatcggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct-gtaaaaaaaaacttttgtttttggtccc |
8946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0535; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 159 - 212
Target Start/End: Original strand, 8734 - 8787
Alignment:
| Q |
159 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
8734 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
8787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0347 (Bit Score: 53; Significance: 3e-21; HSPs: 2)
Name: scaffold0347
Description:
Target: scaffold0347; HSP #1
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 154 - 238
Target Start/End: Complemental strand, 4315 - 4232
Alignment:
| Q |
154 |
attggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||| ||| ||| ||||| ||||| |||||||| ||||| |
|
|
| T |
4315 |
attggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttgagt-ccttgtaaaaaaaaatttgtttttcgtccc |
4232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0347; HSP #2
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 164 - 212
Target Start/End: Original strand, 4016 - 4064
Alignment:
| Q |
164 |
atatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
4016 |
atatggttttagtccctacaaatatgcctcgttttggttttagtccctg |
4064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160 (Bit Score: 52; Significance: 1e-20; HSPs: 3)
Name: scaffold0160
Description:
Target: scaffold0160; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 27364 - 27309
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27364 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
27309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 157 - 199
Target Start/End: Original strand, 27000 - 27042
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttg |
199 |
Q |
| |
|
|||| |||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
27000 |
ggctcaaatttggttttggtccctgcaaatatgtctcgttttg |
27042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 170 - 212
Target Start/End: Original strand, 27072 - 27114
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
27072 |
ttttggtccctgcaaatatgcctcgttttggttttggtccctg |
27114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 52; Significance: 1e-20; HSPs: 5)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 47925 - 47980
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47925 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
47980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #2
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 223172 - 223120
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
223172 |
ggctaaaatatggttttggtccctgcaaatatgtctcactttggttttagtcc |
223120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #3
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 160 - 208
Target Start/End: Complemental strand, 48228 - 48180
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
48228 |
taaaatatggttttggtccctgcaaatatgcctcattttggttttagtc |
48180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #4
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 170 - 211
Target Start/End: Original strand, 222884 - 222925
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccct |
211 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
222884 |
ttttggtccctgcaaatatgtctcgttttggttttggtccct |
222925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #5
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 161 - 212
Target Start/End: Original strand, 222817 - 222868
Alignment:
| Q |
161 |
aaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||| ||||||||||| ||||||| ||| |||||||||||||| |||| |
|
|
| T |
222817 |
aaaatatgattttagtccctccaaatatttcttgttttggttttagttcctg |
222868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 52; Significance: 1e-20; HSPs: 3)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 148282 - 148227
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
148282 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
148227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001; HSP #2
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 157 - 226
Target Start/End: Complemental strand, 121044 - 120975
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaatt |
226 |
Q |
| |
|
|||||||||||| |||| |||||||||||||| | |||| |||||| |||||||||||| |||||||| |
|
|
| T |
121044 |
ggctaaaatatgcttttggtccctgcaaatataacgagtttgggttttggtccctggtaaaaaaaaaatt |
120975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 157 - 211
Target Start/End: Original strand, 147890 - 147941
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccct |
211 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||||||| |||||||||||| |
|
|
| T |
147890 |
ggctaaaatatggtttt-gtccctgcaaatat--ctcgttttagttttagtccct |
147941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0712 (Bit Score: 51; Significance: 5e-20; HSPs: 1)
Name: scaffold0712
Description:
Target: scaffold0712; HSP #1
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 5209 - 5291
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg-gtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||| |||||| |||||||| |||||||||||||| |
|
|
| T |
5209 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttattccctgtaaaaataaaattttgtttttggtccc |
5291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0709 (Bit Score: 51; Significance: 5e-20; HSPs: 1)
Name: scaffold0709
Description:
Target: scaffold0709; HSP #1
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 157 - 238
Target Start/End: Original strand, 5229 - 5311
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg-gtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||| |||||| |||||||| |||||||||||||| |
|
|
| T |
5229 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttattccctgtaaaaataaaattttgtttttggtccc |
5311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 50; Significance: 2e-19; HSPs: 2)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 157 - 237
Target Start/End: Complemental strand, 10515 - 10438
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtcc |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||| ||| |||| |||||| |||||||||||| |
|
|
| T |
10515 |
ggctaaaatatggttttagtccctgcaaatatgtctggttttggttttagttcct-gtaa--aaaaaaatgtttttggtcc |
10438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016; HSP #2
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 152 - 209
Target Start/End: Original strand, 10163 - 10220
Alignment:
| Q |
152 |
aaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
10163 |
aaatcggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtcc |
10220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056 (Bit Score: 49; Significance: 8e-19; HSPs: 3)
Name: scaffold0056
Description:
Target: scaffold0056; HSP #1
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 160 - 212
Target Start/End: Complemental strand, 50075 - 50023
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50075 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
50023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056; HSP #2
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 160 - 212
Target Start/End: Complemental strand, 55176 - 55124
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55176 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
55124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056; HSP #3
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 54815 - 54870
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
54815 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctg |
54870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026 (Bit Score: 49; Significance: 8e-19; HSPs: 2)
Name: scaffold0026
Description:
Target: scaffold0026; HSP #1
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 152 - 212
Target Start/End: Complemental strand, 82711 - 82651
Alignment:
| Q |
152 |
aaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
82711 |
aaataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
82651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026; HSP #2
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 82341 - 82396
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
82341 |
ggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtccctg |
82396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 49; Significance: 8e-19; HSPs: 2)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 157 - 229
Target Start/End: Original strand, 75359 - 75429
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtt |
229 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
75359 |
ggctaaaatatggttttgctccctgcaaatatgtctcgttttggttttagtccct-gtaaa-aaaaaattgtt |
75429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024; HSP #2
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 75764 - 75709
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
75764 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
75709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0119 (Bit Score: 46; Significance: 5e-17; HSPs: 1)
Name: scaffold0119
Description:
Target: scaffold0119; HSP #1
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 16722 - 16779
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
16722 |
ttggctaaaatatgattttggtccctgcaaatatatctcgttttggttttagtccctg |
16779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0105 (Bit Score: 46; Significance: 5e-17; HSPs: 2)
Name: scaffold0105
Description:
Target: scaffold0105; HSP #1
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 17968 - 17911
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| ||||| |||||||| |
|
|
| T |
17968 |
ttggctaaaatatggttttagtccctgcaaatatgcctcgtttcggtttcagtccctg |
17911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0105; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 158 - 212
Target Start/End: Original strand, 17651 - 17705
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||| ||||| ||||| ||||||||||| ||||| ||||||||||||| |
|
|
| T |
17651 |
gctaaaatatgattttaatccctacaaatatgtcttgttttagttttagtccctg |
17705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0339 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: scaffold0339
Description:
Target: scaffold0339; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 155 - 207
Target Start/End: Complemental strand, 3457 - 3405
Alignment:
| Q |
155 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
207 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3457 |
ttggctaaaatatagttttagttcctgcaaatatgtctcgttttggttttagt |
3405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0123 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: scaffold0123
Description:
Target: scaffold0123; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 157 - 225
Target Start/End: Complemental strand, 18043 - 17975
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaat |
225 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |||||||||| ||||||||||| ||| ||||||| |
|
|
| T |
18043 |
ggctaaaatatggttttagtccctgcgaatatgcctcgttttggatttagtccctgtaaaaaaaaaaat |
17975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007 (Bit Score: 44; Significance: 8e-16; HSPs: 2)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 156 - 211
Target Start/End: Complemental strand, 2884 - 2829
Alignment:
| Q |
156 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccct |
211 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||| |||||||||| |
|
|
| T |
2884 |
tggctaaaatatggttttggtccctgcaaatatgtctcgttttgagtttagtccct |
2829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 157 - 211
Target Start/End: Original strand, 2501 - 2555
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccct |
211 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||||||| ||||||||||| |
|
|
| T |
2501 |
ggctaaaatatggttttgatccctgcaaatatgcttcgttttgattttagtccct |
2555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 44; Significance: 8e-16; HSPs: 3)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 94057 - 94112
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| ||||||||||||||| |||||| |
|
|
| T |
94057 |
ggctaaaatatggttttagtccctacaaatatgcctcgttttggttttaatccctg |
94112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 158 - 205
Target Start/End: Complemental strand, 94329 - 94282
Alignment:
| Q |
158 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
205 |
Q |
| |
|
||||||||||||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
94329 |
gctaaaatatggttttagtccctacaaatatgcctcgttttggtttta |
94282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 157 - 224
Target Start/End: Original strand, 344937 - 345004
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaa |
224 |
Q |
| |
|
|||| ||||||| |||| ||||||||||||||| | |||| |||||| |||||||||||| |||||| |
|
|
| T |
344937 |
ggctcaaatatgattttggtccctgcaaatatggcgagtttgggttttggtccctggtaaaaaaaaaa |
345004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0684 (Bit Score: 43; Significance: 0.000000000000003; HSPs: 2)
Name: scaffold0684
Description:
Target: scaffold0684; HSP #1
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 157 - 211
Target Start/End: Complemental strand, 2660 - 2606
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccct |
211 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| || |||||||||||||||||| |
|
|
| T |
2660 |
ggctaaaatatggttttggtccctgcaaatatgccttgttttggttttagtccct |
2606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0684; HSP #2
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 157 - 205
Target Start/End: Original strand, 2334 - 2382
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
205 |
Q |
| |
|
||||| ||||||||||| |||||||||||||| || |||||||||||| |
|
|
| T |
2334 |
ggctataatatggttttggtccctgcaaatattccttgttttggtttta |
2382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0085 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 2)
Name: scaffold0085
Description:
Target: scaffold0085; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 157 - 212
Target Start/End: Complemental strand, 35084 - 35029
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
||||||||||||||||| ||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
35084 |
ggctaaaatatggttttgatccgtacaaatatgtctcgttttggttttagtccctg |
35029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0085; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 176 - 214
Target Start/End: Complemental strand, 35006 - 34968
Alignment:
| Q |
176 |
tccctgcaaatatgtctcgttttggttttagtccctggt |
214 |
Q |
| |
|
|||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
35006 |
tccctgtaaatatgtctcgttttggttttggtccctggt |
34968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 2)
Name: scaffold0078
Description:
Target: scaffold0078; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 157 - 208
Target Start/End: Complemental strand, 4079 - 4028
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
208 |
Q |
| |
|
|||||||||| |||||| |||||||||||||||||||||||| ||||||||| |
|
|
| T |
4079 |
ggctaaaatacggttttggtccctgcaaatatgtctcgttttagttttagtc |
4028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 152 - 212
Target Start/End: Original strand, 3747 - 3807
Alignment:
| Q |
152 |
aaattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
212 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||| | |||||||||||| |||||| |
|
|
| T |
3747 |
aaataggctaaaatatggttttggtccctgcaaatatgctttgttttggttttaatccctg |
3807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0472 (Bit Score: 38; Significance: 0.000000000003; HSPs: 1)
Name: scaffold0472
Description:
Target: scaffold0472; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 7264 - 7183
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattgtttttggtccc |
238 |
Q |
| |
|
|||||||||||| |||| ||| |||||||||||||| |||||||||||| | ||| ||| ||||| |||||||||||||| |
|
|
| T |
7264 |
ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttaatttctgtaaaaaaaaaatttgtttttggtccc |
7183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0176 (Bit Score: 37; Significance: 0.00000000001; HSPs: 3)
Name: scaffold0176
Description:
Target: scaffold0176; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 22055 - 22003
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
209 |
Q |
| |
|
||||||||||||||||| |||||| ||||| || ||||||||||||||||||| |
|
|
| T |
22055 |
ggctaaaatatggttttggtcccttcaaatttgcctcgttttggttttagtcc |
22003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0176; HSP #2
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 170 - 211
Target Start/End: Original strand, 21763 - 21804
Alignment:
| Q |
170 |
ttttagtccctgcaaatatgtctcgttttggttttagtccct |
211 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
21763 |
ttttggtccctgcaaatatgtctcgttttggttttggtccct |
21804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0176; HSP #3
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 157 - 201
Target Start/End: Original strand, 21696 - 21739
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggt |
201 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
21696 |
ggctaaaatatggttttgatccctgcaaatatgt-tcgttttggt |
21739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0578 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: scaffold0578
Description:
Target: scaffold0578; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 160 - 207
Target Start/End: Complemental strand, 5067 - 5020
Alignment:
| Q |
160 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
207 |
Q |
| |
|
|||||||||||||| ||| |||||||||| |||||||||||||||||| |
|
|
| T |
5067 |
taaaatatggttttggtctctgcaaatatatctcgttttggttttagt |
5020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0106 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: scaffold0106
Description:
Target: scaffold0106; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 157 - 227
Target Start/End: Complemental strand, 30966 - 30896
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaataaaaaattg |
227 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||| |||||| |||||||||||| ||||||||| |
|
|
| T |
30966 |
ggctaaaatatggttttggtccctgcaaatatagtgagtttgggttttggtccctggtaaaaaaaaaattg |
30896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0204 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: scaffold0204
Description:
Target: scaffold0204; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 159 - 207
Target Start/End: Original strand, 17126 - 17174
Alignment:
| Q |
159 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
207 |
Q |
| |
|
||||||||||||||| |||||| ||||||||| | |||||||||||||| |
|
|
| T |
17126 |
ctaaaatatggttttggtccctccaaatatgtttggttttggttttagt |
17174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 157 - 205
Target Start/End: Complemental strand, 189678 - 189630
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
205 |
Q |
| |
|
||||||||||| ||||| ||| ||||||||||| ||| ||||||||||| |
|
|
| T |
189678 |
ggctaaaatatagtttttgtcgctgcaaatatgcctcattttggtttta |
189630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: scaffold0008
Description:
Target: scaffold0008; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 157 - 205
Target Start/End: Complemental strand, 44206 - 44158
Alignment:
| Q |
157 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
205 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||| || ||||||||||| |
|
|
| T |
44206 |
ggctaaaatatggctttggtccctgcaaatatgcttcattttggtttta |
44158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University