View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6794_low_9 (Length: 213)
Name: NF6794_low_9
Description: NF6794
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6794_low_9 |
 | |
|
| [»] chr3 (3 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 209; Significance: 1e-114; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 213
Target Start/End: Original strand, 9857483 - 9857695
Alignment:
| Q |
1 |
ttacggagatgaagagaacctttgtttggaagaggatgaagaggaaattgaggttggggaggaagataatgggttggctcttcctattacaagtgctatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9857483 |
ttacggagatgaagagaacctttgtttggaagaggataaagaggaaattgaggttggggaggaagataatgggttggctcttcctattacaagtgctatt |
9857582 |
T |
|
| Q |
101 |
gaaagtgaaacttatgaagaattagattatgaagtttattttgaagatgattaccgaggatatcaatggaacaatggtttggatgaatttgaagatgaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9857583 |
gaaagtgaaacttatgaagaattagattatgaagtttattttgaagatgattaccgaggatatcaatggaacaatggtttggatgaatttgaagatgaag |
9857682 |
T |
|
| Q |
201 |
aggaaatggaggt |
213 |
Q |
| |
|
||||||||||||| |
|
|
| T |
9857683 |
aggaaatggaggt |
9857695 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 126 - 213
Target Start/End: Original strand, 9857797 - 9857884
Alignment:
| Q |
126 |
attatgaagtttattttgaagatgattaccgaggatatcaatggaacaatggtttggatgaatttgaagatgaagaggaaatggaggt |
213 |
Q |
| |
|
||||||||||| ||| ||||||||||||| ||||||||||||||||| ||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
9857797 |
attatgaagttaattatgaagatgattacggaggatatcaatggaacgttggtttggaagaatatgaagatgaagaggaaatggaggt |
9857884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 128 - 169
Target Start/End: Original strand, 9857712 - 9857753
Alignment:
| Q |
128 |
tatgaagtttattttgaagatgattaccgaggatatcaatgg |
169 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
9857712 |
tatgaagtttattgtgaagatgattacggaggatatcaatgg |
9857753 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University