View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6796_high_18 (Length: 245)
Name: NF6796_high_18
Description: NF6796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6796_high_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 55 - 231
Target Start/End: Original strand, 18460255 - 18460431
Alignment:
| Q |
55 |
ttgcttcccaatttcaaagaataatatgaacctgctccattattcctttgtacataatcatcagtgccctctttccataagcactgtcgtaattataagc |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18460255 |
ttgcttcccaatttcaaagaataatatgaacctgctccattattcctttgtacataatcatcagtgccctctttccataagcactgtcgtaattataagc |
18460354 |
T |
 |
| Q |
155 |
acttaatgaaggcccagccctgtaagccatgaaggaagtcaggaaaatcaacaaagatttcaaaatccattgatgtc |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
18460355 |
acttaatgaaggcccagccctgtaagccatgaaggaagtcaggaacatcaacaaagatttcaaaattcattgatgtc |
18460431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 88 - 179
Target Start/End: Original strand, 26844851 - 26844942
Alignment:
| Q |
88 |
gctccattattcctttgtacataatcatcagtgccctctttccataagcactgtcgtaattataagcacttaatgaaggcccagccctgtaa |
179 |
Q |
| |
|
|||||| |||||| ||||||| || ||||||||| ||||| ||||||||||| || |||||||| |||||||| |||||||| ||||||||| |
|
|
| T |
26844851 |
gctccagtattccattgtacaaaagcatcagtgctctcttcccataagcactatcataattatatgcacttaacgaaggccctgccctgtaa |
26844942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University