View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6796_high_8 (Length: 352)
Name: NF6796_high_8
Description: NF6796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6796_high_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 14 - 334
Target Start/End: Complemental strand, 46186224 - 46185904
Alignment:
| Q |
14 |
aagaatatgaatccaagcaaattttaactactcgatcaaaacttgaggagcatgcttcatttgtttataaaagaaacattttctgcaaatttcaagaaga |
113 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
46186224 |
aagaatatgaatccaagcgcattttaactactggatcaaaacttgaagagcatgcttcatttgtttataaaagaaaaattttctgcaaatttcaagaaga |
46186125 |
T |
 |
| Q |
114 |
gcttgcacagatcaacaatttcactaaaattagaagattcaaagagaaggaccgagatatgagtatgaagtgtctaatggctacaaccctaaagatacct |
213 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
46186124 |
gcttgcacggatcaacaatttcactaaaattagaagattcaaagagaaggaccgagatatgagtatgaagtgtctaatggctacaacccaaaagatacct |
46186025 |
T |
 |
| Q |
214 |
tcattgtacatgtagatttaggccaggagttgctaaatgtggctgccactatatgaattcatgggatttttcaatcaaaaggtattgtgcaaatccctga |
313 |
Q |
| |
|
||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46186024 |
tcattgtccatgtagatttaggccaaaagttgctaaatgtggctgccactatatgaattcatgggatttttcaatcaaaaggtattgtgcaaatccctga |
46185925 |
T |
 |
| Q |
314 |
tcatttcattctgcaacattg |
334 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
46185924 |
tcatttcattctgcaacattg |
46185904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University