View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6796_low_18 (Length: 253)
Name: NF6796_low_18
Description: NF6796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6796_low_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 149; Significance: 8e-79; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 1 - 149
Target Start/End: Complemental strand, 7141362 - 7141214
Alignment:
| Q |
1 |
agttccagcaacaaatacatcctgaaattatagaagaacatgtatagaattcaataatattggactagcaattgcaccttaaaaccataggctaaaatat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7141362 |
agttccagcaacaaatacatcctgaaattatagaagaacatgtatagaattcaataatattggactagcaattgcaccttaaaaccataggctaaaatat |
7141263 |
T |
 |
| Q |
101 |
ttgtgcagaatttaatggaaaaacaaaggaaataggaaattagggttat |
149 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7141262 |
ttgtgcagaatttaatggaaaaacaaaggaaataggaaattagggttat |
7141214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 175 - 243
Target Start/End: Complemental strand, 7141216 - 7141148
Alignment:
| Q |
175 |
tataagttaagtgttactaacccaaatcacagctttgatgttgttgattgtcaattggacatcaaggct |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7141216 |
tataagttaagtgttactaacccaaatcacagctttgatgttgttgattgtcaattggacatcaaggct |
7141148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 176 - 225
Target Start/End: Complemental strand, 7153046 - 7152997
Alignment:
| Q |
176 |
ataagttaagtgttactaacccaaatcacagctttgatgttgttgattgt |
225 |
Q |
| |
|
||||||| | ||| ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
7153046 |
ataagttcattgtaactaacccaaatcacagctttgatgttgttggttgt |
7152997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University