View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6796_low_23 (Length: 236)
Name: NF6796_low_23
Description: NF6796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6796_low_23 |
 |  |
|
| [»] chr5 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 138; Significance: 3e-72; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 95 - 236
Target Start/End: Complemental strand, 41760360 - 41760219
Alignment:
| Q |
95 |
ggatatactgtgatgatgaaaaatctttggagttgttggaaggtttatcatcatcactagaaggggcagaaaaagatttagttaaaccaacaaaaacaag |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
41760360 |
ggatatactgtgatgatgaaaaatctttggagttgttggaaggtttatcatcatcactagaagaggcagaaaaagatttagttaaaccaacaaaaacaag |
41760261 |
T |
 |
| Q |
195 |
gagaccattacaaaggaggaacatgctattcttgtctatgtt |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41760260 |
gagaccattacaaaggaggaacatgctattcttgtctatgtt |
41760219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 141 - 233
Target Start/End: Complemental strand, 41795166 - 41795074
Alignment:
| Q |
141 |
atcatcatcactagaaggggcagaaaaagatttagttaaaccaacaaaaacaaggagaccattacaaaggaggaacatgctattcttgtctat |
233 |
Q |
| |
|
||||||||||||||||| | || |||||||||||||||||||| ||||| ||||||||||| ||||||||||||||| | ||||||||||| |
|
|
| T |
41795166 |
atcatcatcactagaagagttggagaaagatttagttaaaccaacgaaaactaggagaccattgcaaaggaggaacatgttgttcttgtctat |
41795074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 19 - 63
Target Start/End: Complemental strand, 41760442 - 41760398
Alignment:
| Q |
19 |
attggctcattggcctctacgtcaagaacatgatattgtgaacca |
63 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41760442 |
attggctcattggcctctacgtcaagaacatgatattgtgaacca |
41760398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 181 - 234
Target Start/End: Complemental strand, 23507071 - 23507018
Alignment:
| Q |
181 |
ccaacaaaaacaaggagaccattacaaaggaggaacatgctattcttgtctatg |
234 |
Q |
| |
|
||||||||||||||||||||||| || | ||||||||||| ||| ||||||||| |
|
|
| T |
23507071 |
ccaacaaaaacaaggagaccattgcatatgaggaacatgcaatttttgtctatg |
23507018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University