View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6797_high_13 (Length: 260)

Name: NF6797_high_13
Description: NF6797
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6797_high_13
NF6797_high_13
[»] chr2 (1 HSPs)
chr2 (12-241)||(8797106-8797335)


Alignment Details
Target: chr2 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 12 - 241
Target Start/End: Original strand, 8797106 - 8797335
Alignment:
12 gaagaggaagaagagcttccatggttgttgatgttgtccatgaaatagtaacctaaaccaggagtgttttgatggttattttgaagcatgatagaagagg 111  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8797106 gaagaggaagaagagcttccatggttgttgatgttgtccatgaaatagtaacctaaaccaggagtgttttgatggttattttgaagcatgatagaagagg 8797205  T
112 tgttgttattacagttggtgtagtgattgttattattgttagtggaattagggataggaaggaaaagaccggttgtgttgtttgcattagtattgttgtt 211  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8797206 tgttgttattacagttggtgtagtgattgttattattgttagtggaattagggataggaaggaaaagaccggttgtgttgtttgcattagtattgttgtt 8797305  T
212 attggaatttattggatgatgagcattatg 241  Q
    ||||||||||||||||||||||||||||||    
8797306 attggaatttattggatgatgagcattatg 8797335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University