View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6797_high_3 (Length: 435)
Name: NF6797_high_3
Description: NF6797
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6797_high_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 400; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 400; E-Value: 0
Query Start/End: Original strand, 18 - 421
Target Start/End: Complemental strand, 7666104 - 7665701
Alignment:
| Q |
18 |
aacatcttcccatacctgagtgggtattggtagaggctgcaacaaccctgctggcagtgtagtcatatgtttagcctgctgacagatcagacattctgtg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7666104 |
aacatcttcccatacctgagtgggtattggcagaggctgcaacaaccctgctggcagtgtagtcatatgtttagcctgctgacagatcagacattctgtg |
7666005 |
T |
|
| Q |
118 |
atgaacttgtgaaccgccgtcttcatatttggccaataaaattcagcacttattcgtgccatagtcctagtaatgcctgcatgccctccaatcggtgaag |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7666004 |
atgaacttgtgaaccgccgtcttcatatttggccaataaaattcagcacttattcgtgccatagtcctagtaatgcctgcatgccctccaatcggtgaag |
7665905 |
T |
|
| Q |
218 |
catgaaactcttgcaacacttgttggattaatgaactatccaccggcaaaactagtttgttcttccagtataataagccttctttcactgtgtagttact |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7665904 |
catgaaactcttgcaacacttgttggattaatgaactatccaccggcaaaactagtttgttcttccagtataataagccttctttcactgtgtagttact |
7665805 |
T |
|
| Q |
318 |
gtcagtgactgtattattgaggcattgttgtacaatagtttgtaagtgatcattctttgcaagttcagctttcaattgcttcagaaatgagttctcaact |
417 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7665804 |
gtcagtgactgtattattgaggcattgttgtacaatagtttgtaagtgatcattctttgcaagttcagctttcaattgcttcagaaatgagttctcaact |
7665705 |
T |
|
| Q |
418 |
gatg |
421 |
Q |
| |
|
|||| |
|
|
| T |
7665704 |
gatg |
7665701 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University