View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6797_low_15 (Length: 251)

Name: NF6797_low_15
Description: NF6797
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6797_low_15
NF6797_low_15
[»] chr2 (1 HSPs)
chr2 (1-251)||(3285120-3285370)


Alignment Details
Target: chr2 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 251
Target Start/End: Original strand, 3285120 - 3285370
Alignment:
1 tggggttatttatgatagagtttttatttttaggttcaaataatcatgacaaatnnnnnnngttggtcagatagtaaattcagatttgacaattgacaag 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||       |||||||||||| ||||||||||||||||||||||||||    
3285120 tggggttatttatgatagagtttttatttttaggttcaaataatcatgacaaataaaaaaagttggtcagatactaaattcagatttgacaattgacaag 3285219  T
101 gtttttaagttttaacttcttccatcaaccaattgggaattgatgaataatcatgaatagaatctacaacacattaagttactatcgcatctctttacca 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
3285220 gtttttaagttttaacttcttccatcaaccaattgggaattgatgaataatcatgaatagaatctacaacacattaagttactattgcatctctttacca 3285319  T
201 aaatgaagaaaagcttaagcatactagtatgaaagtttgacaaattcaagg 251  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||    
3285320 aaatgaagaaaagcttaagcatactagtatgaaagtttgacaaattcaagg 3285370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University