View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6797_low_4 (Length: 392)

Name: NF6797_low_4
Description: NF6797
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6797_low_4
NF6797_low_4
[»] scaffold0010 (1 HSPs)
scaffold0010 (172-377)||(139724-139929)


Alignment Details
Target: scaffold0010 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: scaffold0010
Description:

Target: scaffold0010; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 172 - 377
Target Start/End: Complemental strand, 139929 - 139724
Alignment:
172 gtcaaacttagaagggatgggatatgtatggctagatcattctagctgagattgaaacatgatttgatttggagcacctctatggttttgtttggtattg 271  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
139929 gtcaaacttagaagggatgggatatgtatggctagatcattctagctgagattgaaacatgatttgatttggagcacctctatggttttgtttggtattg 139830  T
272 gtttatatgggtcaatgccttaatcttcacttggggatgatgactcctaccttttgtagttactccctaggctgataagttgtttaagatgattttgatt 371  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||    
139829 gtttatatgggtcaatgccttaatcttcacttggggatgatgactcctaccttttgtagttactccctaggctgataagttgttttagataattttgatt 139730  T
372 gatgtc 377  Q
    ||||||    
139729 gatgtc 139724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University