View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6797_low_4 (Length: 392)
Name: NF6797_low_4
Description: NF6797
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6797_low_4 |
 |  |
|
| [»] scaffold0010 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0010 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: scaffold0010
Description:
Target: scaffold0010; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 172 - 377
Target Start/End: Complemental strand, 139929 - 139724
Alignment:
| Q |
172 |
gtcaaacttagaagggatgggatatgtatggctagatcattctagctgagattgaaacatgatttgatttggagcacctctatggttttgtttggtattg |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
139929 |
gtcaaacttagaagggatgggatatgtatggctagatcattctagctgagattgaaacatgatttgatttggagcacctctatggttttgtttggtattg |
139830 |
T |
 |
| Q |
272 |
gtttatatgggtcaatgccttaatcttcacttggggatgatgactcctaccttttgtagttactccctaggctgataagttgtttaagatgattttgatt |
371 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
139829 |
gtttatatgggtcaatgccttaatcttcacttggggatgatgactcctaccttttgtagttactccctaggctgataagttgttttagataattttgatt |
139730 |
T |
 |
| Q |
372 |
gatgtc |
377 |
Q |
| |
|
|||||| |
|
|
| T |
139729 |
gatgtc |
139724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University