View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6797_low_9 (Length: 309)
Name: NF6797_low_9
Description: NF6797
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6797_low_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 1 - 230
Target Start/End: Original strand, 37047173 - 37047402
Alignment:
| Q |
1 |
tttatttagcgagaaattagactttaaagnnnnnnnngtaagtcctgcataaatagtttgtttgttgaggtaagaaacgttgaaaaagtttgatagagaa |
100 |
Q |
| |
|
|||||||||| || ||||||||||||||| ||| ||||||||||||||||||| ||| |||| |||||||||||||| ||||||||| ||||| |
|
|
| T |
37047173 |
tttatttagccagtaattagactttaaagcacaaaaagtatgtcctgcataaatagtttggttggtgagttaagaaacgttgaagaagtttgatggagaa |
37047272 |
T |
|
| Q |
101 |
agtaattcgaaattcgattctcataaactaacataaccactaacaaccaatttaaattggtctaatgatattggcttgagatttgtcagtgtggctcttc |
200 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||| | ||||||| ||||||||||||||||| |||| |||||| |||| | |
|
|
| T |
37047273 |
agtaatttgaaattcgattctcataaactaacataaccactaacaaccaatttgagttggtctgatgatattggcttgagacttgtgagtgtgcctctcc |
37047372 |
T |
|
| Q |
201 |
tcaaagtctcgaaccataatttaacttatt |
230 |
Q |
| |
|
| || ||||| ||||||||||||||||||| |
|
|
| T |
37047373 |
taaaggtctcaaaccataatttaacttatt |
37047402 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University