View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6803_low_12 (Length: 239)
Name: NF6803_low_12
Description: NF6803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6803_low_12 |
 | |
|
| [»] chr1 (4 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 211; Significance: 1e-116; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 1463479 - 1463715
Alignment:
| Q |
1 |
tggtgttaggtctttgagaaataatcctgctgagatgatggcagctctatacctgcaagtcagtataataagccaagcgctaatttttgtaactaggtct |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1463479 |
tggtgtgaggtctttgagaaataatcctgctgagatgatggcagctctatacctgcaagtcagtataataagccaagcgctaatttttgtaactaggtct |
1463578 |
T |
|
| Q |
101 |
cgcaattggtctttcgccgatagacctggtcttctcctactaggcgcttttgtcctcgctcagctagtaagcttgaaccttttattcttcaaataactag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
1463579 |
cgcaattggtctttcgccgatagacctggtcttctcctactaggcgcttttgtcctcgctcagctggtaagcttgaacc-tttattcttcaaataactag |
1463677 |
T |
|
| Q |
201 |
ttttttaaaaaataataattgcataaaattttatcactt |
239 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
1463678 |
tttttt-aaaaataataactgcataaaattttatcactt |
1463715 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 21 - 192
Target Start/End: Complemental strand, 1496166 - 1495995
Alignment:
| Q |
21 |
ataatcctgctgagatgatggcagctctatacctgcaagtcagtataataagccaagcgctaatttttgtaactaggtctcgcaattggtctttcgccga |
120 |
Q |
| |
|
||||||||| |||||||||||| ||| |||| || ||||| ||||||||||||||||| ||||||||||||||||| || |||| ||||||||||||||| |
|
|
| T |
1496166 |
ataatcctgatgagatgatggcggctttatatctacaagttagtataataagccaagcactaatttttgtaactagatcacgcagttggtctttcgccga |
1496067 |
T |
|
| Q |
121 |
tagacctggtcttctcctactaggcgcttttgtcctcgctcagctagtaagcttgaaccttttattcttcaa |
192 |
Q |
| |
|
|||||||||||||||||||| || |||||| || | ||||| || |||| | ||||||| ||||||||||| |
|
|
| T |
1496066 |
aagacctggtcttctcctacttggtgcttttctcattgctcaactggtaaacctgaacctcttattcttcaa |
1495995 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 92 - 151
Target Start/End: Complemental strand, 1489399 - 1489340
Alignment:
| Q |
92 |
actaggtctcgcaattggtctttcgccgatagacctggtcttctcctactaggcgctttt |
151 |
Q |
| |
|
||||||||||||| ||| ||||| ||||| | ||||| ||||||||||||||| |||||| |
|
|
| T |
1489399 |
actaggtctcgcagttgatcttttgccgaaaaacctgatcttctcctactaggtgctttt |
1489340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 124 - 168
Target Start/End: Original strand, 1491396 - 1491440
Alignment:
| Q |
124 |
acctggtcttctcctactaggcgcttttgtcctcgctcagctagt |
168 |
Q |
| |
|
||||| |||||||||| |||||||||||||| | ||||||||||| |
|
|
| T |
1491396 |
acctgatcttctcctattaggcgcttttgtcattgctcagctagt |
1491440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 114; Significance: 6e-58; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 26791229 - 26791426
Alignment:
| Q |
1 |
tggtgttaggtctttgagaaataatcctgctgagatgatggcagctctatacctgcaagtcagtataataagccaagcgctaatttttgtaactaggtct |
100 |
Q |
| |
|
|||||| |||||||||||| ||| ||||| |||||||||||||||| | ||||| ||||||||||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
26791229 |
tggtgtgaggtctttgagagatagtcctgatgagatgatggcagctttgtacctacaagtcagtataataagccaagcactaattttcgtaactaggtct |
26791328 |
T |
|
| Q |
101 |
cgcaattggtctttcgccgatagacctggtcttctcctactaggcgcttttgtcctcgctcagctagtaagcttgaaccttttattcttcaaataact |
198 |
Q |
| |
|
|||||||||||| || | ||||||||||||||||||||||||||||||||| | | |||||||| ||||||||||| || |||||| ||||| |||| |
|
|
| T |
26791329 |
cgcaattggtctgtcactgatagacctggtcttctcctactaggcgcttttctagttgctcagctggtaagcttgaatctcttattcatcaaacaact |
26791426 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 17 - 99
Target Start/End: Original strand, 50277026 - 50277108
Alignment:
| Q |
17 |
agaaataatcctgctgagatgatggcagctctatacctgcaagtcagtataataagccaagcgctaatttttgtaactaggtc |
99 |
Q |
| |
|
||||| || |||| ||| ||||||||||| || ||||| ||||||||||| ||||| || || ||||||||||| || ||||| |
|
|
| T |
50277026 |
agaaacaaccctgatgaaatgatggcagccctctacctacaagtcagtattataagtcaggcactaatttttgtcaccaggtc |
50277108 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University