View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6803_low_7 (Length: 317)
Name: NF6803_low_7
Description: NF6803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6803_low_7 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 92; Significance: 1e-44; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 196 - 317
Target Start/End: Original strand, 20336482 - 20336596
Alignment:
| Q |
196 |
gtgatagttaggcaaaccaaagccgtccctaaagaaatccacacaaatgcctgtagcctgtaggcactcaacaaaccaaaccgatccatgaatgcctata |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20336482 |
gtgatagttaggcaaaccaaagccgtccctaaagaaatccacacaaattcctg-------taggcactcaacaaaccaaaccgatccatgaatgcctata |
20336574 |
T |
 |
| Q |
296 |
ggcacttaacaacaactgcctt |
317 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
20336575 |
ggcacttaacaacaactgcctt |
20336596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 11 - 80
Target Start/End: Original strand, 20336298 - 20336367
Alignment:
| Q |
11 |
ggacatcaagagaaaacatcgacatttcaattggattgacaccccattgagattgcttatcctacgccgc |
80 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
20336298 |
ggacatcaagagaaaacatcgacattccaattaaattgacaccccgttgagattgcttatcctacgccgc |
20336367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University