View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6806_low_2 (Length: 378)
Name: NF6806_low_2
Description: NF6806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6806_low_2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 345; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 345; E-Value: 0
Query Start/End: Original strand, 9 - 357
Target Start/End: Complemental strand, 30429576 - 30429228
Alignment:
| Q |
9 |
gatgaacagcccaaaacatctcattaaattctttaacaccacttttagccatcaatttcttgcaaaattcttcaatgttgtcttcaattttttgaggaag |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30429576 |
gatgaacagcccaaaacatctcattaaattctttaacaccacttttagccatcaatttcttgcaaaattcttcaatgttgtcttcaattttttgaggaag |
30429477 |
T |
|
| Q |
109 |
atctcttccaagcttaaaattaataccctcttcagtaattctaccgtcaatcacattttgtgtattaggcaagaattgttggacagcatagttcaattcc |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30429476 |
atctcttccaagcttaaaattaataccctcttcagtaattctaccatcaatcacattttgtgtattaggcaagaattgttggacagcatagttcaattcc |
30429377 |
T |
|
| Q |
209 |
atgaaaggtctttcttgattcggtaaagggtttgttccgattatagctgcagcagcaccgtcaccaaaaagtgcggcgccaacaagatcataaggtctag |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30429376 |
atgaaaggtctttcttgattcggtaaagggtttgttccgattatagctgcagcagcaccgtcaccaaaaagtgcggcgccaacaagatcataaggtctag |
30429277 |
T |
|
| Q |
309 |
ctttgtttggtggtcgaaaaccaagtattgttgtttcagaagttgtgag |
357 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30429276 |
ctttgtttggtggtcgaaaaccaagtattgttgtttcagaagttgtgag |
30429228 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University