View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6806_low_8 (Length: 229)
Name: NF6806_low_8
Description: NF6806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6806_low_8 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 32489829 - 32489600
Alignment:
| Q |
1 |
tcacacaaacaaagcttctaata-ctaattcagagactttaatttacaattctcaagattttcaaagttacaaatttaccaccccaaagccccttccatc |
99 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32489829 |
tcacacaaacaaagcttctaataactaattcagagactttaatttacaattctcaagattttcaaagttacaaatttaccaccccaaagccccttccatc |
32489730 |
T |
 |
| Q |
100 |
actaaagttattaggcaaccacctttgatttattggactaaatgcaatacagatagagcttcttccggtaatctaggagcctcctcttgtggagaaattt |
199 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||| |
|
|
| T |
32489729 |
actaaagttattaagcaaccacctttgattcattggactaaatgcaatacagatagagcttcttccggtaatctaggagcctcctcttgtggaggagttt |
32489630 |
T |
 |
| Q |
200 |
tcaaagattataaaggtaactgtttagatt |
229 |
Q |
| |
|
||| |||||||||||||||||||||||||| |
|
|
| T |
32489629 |
tcagagattataaaggtaactgtttagatt |
32489600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University