View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6807_high_7 (Length: 313)

Name: NF6807_high_7
Description: NF6807
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6807_high_7
NF6807_high_7
[»] chr4 (1 HSPs)
chr4 (99-313)||(34162646-34162858)
[»] chr1 (3 HSPs)
chr1 (205-313)||(41112892-41112999)
chr1 (205-313)||(52314391-52314498)
chr1 (208-305)||(43688757-43688853)
[»] chr3 (1 HSPs)
chr3 (207-313)||(2191774-2191880)


Alignment Details
Target: chr4 (Bit Score: 143; Significance: 4e-75; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 99 - 313
Target Start/End: Complemental strand, 34162858 - 34162646
Alignment:
99 taatggccactttacgaaattcctacagagctttcttctcccgtctcccattttttccataatttctttctctggccgtcatgttttaactttgtaattg 198  Q
    ||||||||||||||||||||||||||| |||||||||||||||||| ||| |||||||| |||||||||||||||||||||||||||||||| |||||||    
34162858 taatggccactttacgaaattcctacaaagctttcttctcccgtcttccagtttttccagaatttctttctctggccgtcatgttttaacttcgtaattg 34162759  T
199 taccctagcctggattgatgaggttctttttactggtcgagtgactttgctactcaaacacaggtgcagacttacgctcaaatttgggtaggacttttac 298  Q
    ||||||||||||||||||||||||| ||||| |||||| ||||||| || |||| |||||||||| |||||| ||||||||||||||||| |||||||||    
34162758 taccctagcctggattgatgaggtt-tttttgctggtc-agtgactgtgatacttaaacacaggttcagactcacgctcaaatttgggtacgacttttac 34162661  T
299 ccttgcctcgggaat 313  Q
     ||||||||| ||||    
34162660 gcttgcctcgagaat 34162646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 53; Significance: 2e-21; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 205 - 313
Target Start/End: Original strand, 41112892 - 41112999
Alignment:
205 agcctggattgatgaggttctttttactggtcgagtgactttgctactcaaacacaggtgcagacttacgctcaaatttgggtaggacttttacccttgc 304  Q
    |||||||||||||||| || |||||  |||||||| ||||||| ||||||||||||||| || ||| ||||||| ||||||||| | ||||||| |||||    
41112892 agcctggattgatgagctt-tttttgttggtcgagagactttgatactcaaacacaggttcaaactcacgctcagatttgggtacggcttttacgcttgc 41112990  T
305 ctcgggaat 313  Q
    |||||||||    
41112991 ctcgggaat 41112999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 205 - 313
Target Start/End: Original strand, 52314391 - 52314498
Alignment:
205 agcctggattgatgaggttctttttactggtcgagtgactttgctactcaaacacaggtgcagacttacgctcaaatttgggtaggacttttacccttgc 304  Q
    ||||||||||||| ||||| |||||  |||||||||||||||| ||||||||||||||| |||||| | || || ||||||||| ||||||||| |||||    
52314391 agcctggattgataaggtt-tttttgttggtcgagtgactttgatactcaaacacaggttcagactcatgcccagatttgggtacgacttttacgcttgc 52314489  T
305 ctcgggaat 313  Q
    ||| |||||    
52314490 ctcaggaat 52314498  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 208 - 305
Target Start/End: Original strand, 43688757 - 43688853
Alignment:
208 ctggattgatgaggttctttttactggtcgagtgactttgctactcaaacacaggtgcagacttacgctcaaatttgggtaggacttttacccttgcc 305  Q
    |||| ||||| ||||| ||||| ||||||||||||||||| ||||||||||||||| |||||| | ||| | ||||||||| ||||||||| ||||||    
43688757 ctgggttgataaggtt-tttttgctggtcgagtgactttgatactcaaacacaggttcagactcatgcttagatttgggtacgacttttacgcttgcc 43688853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 207 - 313
Target Start/End: Original strand, 2191774 - 2191880
Alignment:
207 cctggattgatgaggttctttttactggtcgagtgactttgctactcaaacacaggtgcagacttacgctcaaatttgggtaggacttttacccttgcct 306  Q
    ||||| |||||||| || ||| | |||| |||||||||||| ||||||| |||| || | |||| |||| || ||||||||| |  |||||| |||||||    
2191774 cctggcttgatgagtttttttctgctggacgagtgactttgatactcaatcacaagttccgactcacgcccagatttgggtaaggtttttacgcttgcct 2191873  T
307 cgggaat 313  Q
    | |||||    
2191874 caggaat 2191880  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University