View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6807_low_13 (Length: 337)
Name: NF6807_low_13
Description: NF6807
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6807_low_13 |
 |  |
|
| [»] chr3 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 95; Significance: 2e-46; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 235 - 337
Target Start/End: Complemental strand, 12079079 - 12078977
Alignment:
| Q |
235 |
acaaatcataaaaaatattgtcaccaaattagtaaattttgcacacaatcaaatcagattctaatgtcatgaaatattctctccaacaaaataaattcac |
334 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
12079079 |
acaattcataaaaaatattgtcaccaaattagtaaattttgcacacaatcaaatcagattctaatgtcatgaaatattctctccaacaaaaaaaattcac |
12078980 |
T |
 |
| Q |
335 |
taa |
337 |
Q |
| |
|
||| |
|
|
| T |
12078979 |
taa |
12078977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 3 - 126
Target Start/End: Complemental strand, 12079268 - 12079145
Alignment:
| Q |
3 |
atcaaatcggattataatatgttaattttttagtttctaaaannnnnnnnnnnatggaaattcctataatatctctccaactactttaatggtgcgattc |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
12079268 |
atcaaatcggattataatatgttaattttttagtttctaaaatttctttttttatggaaattcccataatatctctccaactactttaatggtgcgattc |
12079169 |
T |
 |
| Q |
103 |
gatttgatacttgtgtcaaataaa |
126 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
12079168 |
gatttgatacttgtgtcaaataaa |
12079145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 184 - 225
Target Start/End: Complemental strand, 12079106 - 12079063
Alignment:
| Q |
184 |
gtgattactataatttctatagcaa--acaattcatgaaaaata |
225 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
12079106 |
gtgattactataatttctatagcaaacacaattcataaaaaata |
12079063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University