View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6807_low_13 (Length: 337)

Name: NF6807_low_13
Description: NF6807
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6807_low_13
NF6807_low_13
[»] chr3 (3 HSPs)
chr3 (235-337)||(12078977-12079079)
chr3 (3-126)||(12079145-12079268)
chr3 (184-225)||(12079063-12079106)


Alignment Details
Target: chr3 (Bit Score: 95; Significance: 2e-46; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 235 - 337
Target Start/End: Complemental strand, 12079079 - 12078977
Alignment:
235 acaaatcataaaaaatattgtcaccaaattagtaaattttgcacacaatcaaatcagattctaatgtcatgaaatattctctccaacaaaataaattcac 334  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
12079079 acaattcataaaaaatattgtcaccaaattagtaaattttgcacacaatcaaatcagattctaatgtcatgaaatattctctccaacaaaaaaaattcac 12078980  T
335 taa 337  Q
    |||    
12078979 taa 12078977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 3 - 126
Target Start/End: Complemental strand, 12079268 - 12079145
Alignment:
3 atcaaatcggattataatatgttaattttttagtttctaaaannnnnnnnnnnatggaaattcctataatatctctccaactactttaatggtgcgattc 102  Q
    ||||||||||||||||||||||||||||||||||||||||||           ||||||||||| |||||||||||||||||||||||||||||||||||    
12079268 atcaaatcggattataatatgttaattttttagtttctaaaatttctttttttatggaaattcccataatatctctccaactactttaatggtgcgattc 12079169  T
103 gatttgatacttgtgtcaaataaa 126  Q
    ||||||||||||||||||||||||    
12079168 gatttgatacttgtgtcaaataaa 12079145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 184 - 225
Target Start/End: Complemental strand, 12079106 - 12079063
Alignment:
184 gtgattactataatttctatagcaa--acaattcatgaaaaata 225  Q
    |||||||||||||||||||||||||  ||||||||| |||||||    
12079106 gtgattactataatttctatagcaaacacaattcataaaaaata 12079063  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University