View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6807_low_17 (Length: 283)
Name: NF6807_low_17
Description: NF6807
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6807_low_17 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 13 - 283
Target Start/End: Original strand, 12543543 - 12543815
Alignment:
| Q |
13 |
tcatcagtttgcttaaggctccgccctatc--ttgttcggtacttttctccagctgtcatttcaaattttaaggcacttaattccctttgttacaatgtg |
110 |
Q |
| |
|
||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12543543 |
tcatcagtttgcttaaggctccgccatatcccttgttcggtacttttctccagctgtcatttcaaattttaaggcacttaattccctttgttacaatgtg |
12543642 |
T |
 |
| Q |
111 |
ttccttcatgtaatatttggatgagatccttctattttatacaatttttgtttccagcaaatatggcttagcggtggtggtgtttattgtatgtttctca |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
12543643 |
ttccttcatgtaatatttggatgagatccttctattttatacaatttttgtttccagcaaatatggcttatcggtggtggtgtttattgtatgtttctca |
12543742 |
T |
 |
| Q |
211 |
atccttattgaaccttactatgttttaatggagaaattcagtgttgtatcgcctaccaaattttgccgtcatt |
283 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
12543743 |
atccttattgaaccttattatgttttaatggagaaattcagtgttgtatcgactaccaaattttgccgtcatt |
12543815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University