View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6807_low_18 (Length: 274)
Name: NF6807_low_18
Description: NF6807
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6807_low_18 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 17 - 274
Target Start/End: Complemental strand, 44211565 - 44211308
Alignment:
| Q |
17 |
gctggtcaattgcaagaggcttttgacatcatcaaatgtatgccgtttgagccgacggcagctatgtggggatccttgttgcttggttcgaaatctcttg |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| || |
|
|
| T |
44211565 |
gctggtcaattgcaagaggcttttgacatcatcaaatgtatgccgtttgagccgacggcagctatgtggggatccttattgcttggttcgaaatctcgtg |
44211466 |
T |
 |
| Q |
117 |
gtgacttggaattcagtgagtttgcagctacaaaattggttgagttggagccatataacactgcctattatgttcaactgtcaaatctgtatgcagaggc |
216 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44211465 |
atgacttggaattcagtgagtttgcggctacaaaattggttgagttggagccatataacactgcctattatgttcaactgtcaaatctgtatgcagaggc |
44211366 |
T |
 |
| Q |
217 |
cggaagatggagcgatgttgagaggataagaggaatgatgaaagaaagaggactgact |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44211365 |
cggaagatggagcgatgttgagaggataagaggaatgatgaaagaaagaggactgact |
44211308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University