View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6807_low_19 (Length: 260)
Name: NF6807_low_19
Description: NF6807
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6807_low_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 105; Significance: 2e-52; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 115 - 254
Target Start/End: Original strand, 8157129 - 8157266
Alignment:
| Q |
115 |
ttttttggttttataaatatatgagtctctcttgttatgttattttttaggtttacctatatgatagttcaatgaaatttatatgttgttcaatgaaatg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| | | |||||||||||||||||||||||||||||||||||| |
|
|
| T |
8157129 |
ttttttggttttataaatatatgagtctctcttgttatgttattttttaggttttctccact--tagttcaatgaaatttatatgttgttcaatgaaatg |
8157226 |
T |
 |
| Q |
215 |
aatgttgatctatatttatttttctgttcaatgtgaaact |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8157227 |
aatgttgatctatatttatttttctgttcaatgtgaaact |
8157266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 54 - 123
Target Start/End: Original strand, 8157023 - 8157092
Alignment:
| Q |
54 |
taaaaacaattacataagttggttcgacgccatatctttaccactttagattatcataatattttttggt |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8157023 |
taaaaacaattacataagttggttcgacgccatatctttaccactttagattatcataatattttttggt |
8157092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 18 - 59
Target Start/End: Original strand, 8156664 - 8156705
Alignment:
| Q |
18 |
acatattcatggagttttggacattgagatttgagataaaaa |
59 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8156664 |
acatattcatggagttttggacattgagatttgagataaaaa |
8156705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University