View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6807_low_20 (Length: 256)

Name: NF6807_low_20
Description: NF6807
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6807_low_20
NF6807_low_20
[»] chr7 (1 HSPs)
chr7 (12-254)||(44210944-44211186)


Alignment Details
Target: chr7 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 12 - 254
Target Start/End: Original strand, 44210944 - 44211186
Alignment:
12 gacatcatacttttgccggcaatggcgagttgatttagtgatggtgtttttgtaaactaaataacctaataccagctcattgatatcaatgacaatattt 111  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44210944 gacatcatacttttgccggcaatggcgagttgatttagtgatggtgtttttgtaaactaaataacctaataccagctcattgatatcaatgacaatattt 44211043  T
112 tcaggatgctcaacatctgtaggagcttaacaggaatactgaccccatatgagttactttctcagtgaatgagctatcatttgtcccatccttcaataaa 211  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
44211044 tcaggatgctcaacatctgtaggagcttaacaggaatactgaccccatatgagttactttctcagtgaatgagctatcatttgtaccatccttcaataaa 44211143  T
212 tacatattgtagcagagcagctccctatcagaagtaactgcta 254  Q
    |||||||||||||||||||||||||||||||||||||||||||    
44211144 tacatattgtagcagagcagctccctatcagaagtaactgcta 44211186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University