View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6807_low_20 (Length: 256)
Name: NF6807_low_20
Description: NF6807
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6807_low_20 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 12 - 254
Target Start/End: Original strand, 44210944 - 44211186
Alignment:
| Q |
12 |
gacatcatacttttgccggcaatggcgagttgatttagtgatggtgtttttgtaaactaaataacctaataccagctcattgatatcaatgacaatattt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44210944 |
gacatcatacttttgccggcaatggcgagttgatttagtgatggtgtttttgtaaactaaataacctaataccagctcattgatatcaatgacaatattt |
44211043 |
T |
|
| Q |
112 |
tcaggatgctcaacatctgtaggagcttaacaggaatactgaccccatatgagttactttctcagtgaatgagctatcatttgtcccatccttcaataaa |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
44211044 |
tcaggatgctcaacatctgtaggagcttaacaggaatactgaccccatatgagttactttctcagtgaatgagctatcatttgtaccatccttcaataaa |
44211143 |
T |
|
| Q |
212 |
tacatattgtagcagagcagctccctatcagaagtaactgcta |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44211144 |
tacatattgtagcagagcagctccctatcagaagtaactgcta |
44211186 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University