View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6807_low_24 (Length: 235)
Name: NF6807_low_24
Description: NF6807
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6807_low_24 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 89; Significance: 5e-43; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 17 - 144
Target Start/End: Original strand, 32486597 - 32486718
Alignment:
| Q |
17 |
cgtgttcgagtcccaacctaaattttcaaaactccacattatatacggtttcaaccattaatttgggaggatgtcttacataatcacaaatatttaggcg |
116 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||| |||||||||||| ||||||||||||||| |
|
|
| T |
32486597 |
cgtgtttgagtcccaacctaaattttcaaaactccacattatat------tcaaccattaatttaggaggaagtcttacataattacaaatatttaggcg |
32486690 |
T |
|
| Q |
117 |
catagaaacgcaaaaatactaatctctt |
144 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
32486691 |
catagaaacgcaaaaatactaatctctt |
32486718 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 141 - 218
Target Start/End: Original strand, 32486748 - 32486825
Alignment:
| Q |
141 |
tctttttgctctctaatttttctcaagtgtttgagtgtgtttaaatagagtatgagtttcacactagtgtaccttagt |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32486748 |
tctttttgctctctaatttttctcaagtgtttgagtgtgattaaatagagtatgagtttcacactagtgtaccttagt |
32486825 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University