View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6808_high_13 (Length: 316)
Name: NF6808_high_13
Description: NF6808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6808_high_13 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 102; Significance: 1e-50; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 173 - 297
Target Start/End: Complemental strand, 10827043 - 10826918
Alignment:
| Q |
173 |
aaagtgtcgatgctatataaataagatagaatctaagatagattattgttggttcttggttaattgatcttgtgattca-tttgttgattggtaattata |
271 |
Q |
| |
|
||||||||||||||||||| || ||||| ||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
10827043 |
aaagtgtcgatgctatatagattagataaaatctaagatagattattgttggtttttggttaattgatcttgtgattcattttgttgattggtaattata |
10826944 |
T |
 |
| Q |
272 |
taatgcaggtggagttctggatagat |
297 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
10826943 |
taatgcaggtggagttctggatagat |
10826918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University