View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6808_high_16 (Length: 265)
Name: NF6808_high_16
Description: NF6808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6808_high_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 36 - 246
Target Start/End: Complemental strand, 30032821 - 30032611
Alignment:
| Q |
36 |
aggaagacgagggacggggtaacgttatatcacgcgctatgttccgcgactcgacttgtgcataatgcagagatcacgtaaaggtcgcatggaaagaaga |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30032821 |
aggaagacgagggacggggtaacgttatatcacgcgctatgttccgcgactcgacttgtgcataatgcagagatcacgtaaaggtcgcatggaaagaaga |
30032722 |
T |
|
| Q |
136 |
cctacttcttcctctgcccaaagtttccatttttatcaacttcctctgctttttgatttgtgggttttactcattctcttcagcttattgatcacttgca |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30032721 |
cctacttcttcctctgcccaaagtttccatttttatcaacttcctctgctttttgatttgtgggttttactcattctcttcagcttattgatcacttgca |
30032622 |
T |
|
| Q |
236 |
caggtactaaa |
246 |
Q |
| |
|
||||||||||| |
|
|
| T |
30032621 |
caggtactaaa |
30032611 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 155 - 241
Target Start/End: Original strand, 10545981 - 10546067
Alignment:
| Q |
155 |
aaagtttccatttttatcaacttcctctgctttttgatttgtgggttttactcattctcttcagcttattgatcacttgcacaggta |
241 |
Q |
| |
|
||||||| |||||||| ||||| || || |||||| |||||||| |||||| |||||||||||||||| ||||| || |||||||| |
|
|
| T |
10545981 |
aaagttttaatttttatgaactttctttggtttttgttttgtggggtttacttattctcttcagcttatggatcagttacacaggta |
10546067 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University