View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6808_high_24 (Length: 234)
Name: NF6808_high_24
Description: NF6808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6808_high_24 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 6 - 234
Target Start/End: Complemental strand, 30081132 - 30080903
Alignment:
| Q |
6 |
agatggacatcacacaataaaataatc-tactgagtaggaagttaaatttaccagacctagtagttgctagcatttcctccataacagacaaaattgtca |
104 |
Q |
| |
|
||||| |||| |||||||||||||||| |||||||||||||||||| ||||||| ||||||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
30081132 |
agatgaacattacacaataaaataatcatactgagtaggaagttaagtttaccaaacctagtggttgctagcatttccttcataacagacaaaattgtca |
30081033 |
T |
|
| Q |
105 |
tttgccagtgtcaagtcataccaaaaataatgctacaagatttttccgaaaagaaacttctggtatccatcaccatgtgatgaattgtttcacagatgct |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30081032 |
tttgccagtgtcaagtcataccaaaaataatgctacaagatttgtccgaaaagaaacttctggtatccatcaccatgtgatgaattgtttcacagatgct |
30080933 |
T |
|
| Q |
205 |
aatcttaacatcaatatggagtatacattt |
234 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |
|
|
| T |
30080932 |
aatcttaacatcaatatggagtatgcattt |
30080903 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University