View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6808_low_12 (Length: 373)
Name: NF6808_low_12
Description: NF6808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6808_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 258; Significance: 1e-143; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 10 - 363
Target Start/End: Complemental strand, 33452036 - 33451683
Alignment:
| Q |
10 |
acgcaatctccaccttttcagtgtcatcctcatatatttaagggtgtgcatatcactacatcgctttgaaaatgagccaaacggatttgaacttgactca |
109 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||| || ||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
33452036 |
acgcaacctccaccatttcagtgtcatcctcatatgttcaagggtgtgcatatcactatatcgctttgaaaatgagccaaatggatttgaacttgactca |
33451937 |
T |
 |
| Q |
110 |
attcaactcgataagattttttt-caattcgatttaannnnnnnncgctcgaacttgatttgattaaagttattcaaatatagtacatagcattttatta |
208 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33451936 |
attcaactcaataagattttttttcaattcgatttaatttttttttgctcgaacttgatttgattaaagttattcaaatatagtacatagcattttatta |
33451837 |
T |
 |
| Q |
209 |
tagacgcatacaacaatcaatcaaagctatttgattttgggttgagcccaactcgctatggatcataaaatatatctgcaaggtggaatagtannnnnnn |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33451836 |
tagacgcatacaacaatcaatcaaagctatttgattttgggttgcgcccaactcgctatggatcataaaatatatctgcaaggtggaatagta-tttttt |
33451738 |
T |
 |
| Q |
309 |
ncgataagcaaatattttattaatagcatcttatgcatgttattggctattgaca |
363 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33451737 |
tcgataagcaaatattttattaatagcatcttatgcatgttattggctattgaca |
33451683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University