View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6808_low_15 (Length: 330)
Name: NF6808_low_15
Description: NF6808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6808_low_15 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 306; Significance: 1e-172; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 17 - 326
Target Start/End: Complemental strand, 3521300 - 3520991
Alignment:
| Q |
17 |
tcattctctcaccttccacgtcatcacttcccaccaaaaattcatggggcggacccgaatgggaaaaacgggtcaccaaatcaacccgccataactctcc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3521300 |
tcattctctcaccttccacgtcatcacttcccaccaaaaattcatggggcggacccgaatgggaaaaacgggtcaccaaatcaacccgccataactctcc |
3521201 |
T |
|
| Q |
117 |
ctccggttcaccactcaccgttcttgtcaccggcgcttctggtttcgtcggtatgcatgtctcgctcgctcttaagcgacgtggcgatggggttttaggg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3521200 |
ctccggttcaccactcaccgttcttgtcaccggcgcttctggtttcgtcggtatgcatgtctcgctcgctcttaagcgacgtggcgatggggttttaggg |
3521101 |
T |
|
| Q |
217 |
attgataatttcaatcggtattatgatattaacctcaaacgcactcgtgccaaggttctttcacgcgctggtgtttttgtcgttgaaggtgatatcaatg |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3521100 |
attgataatttcaatcggtattatgatattaacctcaaacgcactcgtgccaaggttctttcacgcgctggtgtttttgtcgttgaaggtgatatcaatg |
3521001 |
T |
|
| Q |
317 |
atgtccatct |
326 |
Q |
| |
|
|||| ||||| |
|
|
| T |
3521000 |
atgttcatct |
3520991 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000005; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 155 - 256
Target Start/End: Complemental strand, 42373731 - 42373630
Alignment:
| Q |
155 |
ctggtttcgtcggtatgcatgtctcgctcgctcttaagcgacgtggcgatggggttttagggattgataatttcaatcggtattatgatattaacctcaa |
254 |
Q |
| |
|
||||||||||||| | |||||| | |||||| | || || || ||||| || ||| | ||||||||||||||||||||||| |||||| ||||||| || |
|
|
| T |
42373731 |
ctggtttcgtcggaagtcatgtcgcactcgctttaaaacgccgcggcgacggtgttcttgggattgataatttcaatcggtactatgatgttaacctaaa |
42373632 |
T |
|
| Q |
255 |
ac |
256 |
Q |
| |
|
|| |
|
|
| T |
42373631 |
ac |
42373630 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 134 - 231
Target Start/End: Complemental strand, 8316348 - 8316251
Alignment:
| Q |
134 |
ccgttcttgtcaccggcgcttctggtttcgtcggtatgcatgtctcgctcgctcttaagcgacgtggcgatggggttttagggattgataatttcaat |
231 |
Q |
| |
|
|||||||||| ||||| ||| ||||||||||||| | |||||||| || |||||||| || || ||||| ||| | |||||||||||||||||| |
|
|
| T |
8316348 |
ccgttcttgtgaccggagctgctggtttcgtcggaacacatgtctccgcggcgcttaagcgtcgcggagatggtgttcttgggattgataatttcaat |
8316251 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 131 - 168
Target Start/End: Complemental strand, 37995596 - 37995559
Alignment:
| Q |
131 |
tcaccgttcttgtcaccggcgcttctggtttcgtcggt |
168 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |
|
|
| T |
37995596 |
tcaccgttcttgtcaccggcgcagctggtttcgtcggt |
37995559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University