View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6808_low_16 (Length: 316)

Name: NF6808_low_16
Description: NF6808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6808_low_16
NF6808_low_16
[»] chr6 (1 HSPs)
chr6 (173-297)||(10826918-10827043)


Alignment Details
Target: chr6 (Bit Score: 102; Significance: 1e-50; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 173 - 297
Target Start/End: Complemental strand, 10827043 - 10826918
Alignment:
173 aaagtgtcgatgctatataaataagatagaatctaagatagattattgttggttcttggttaattgatcttgtgattca-tttgttgattggtaattata 271  Q
    ||||||||||||||||||| || ||||| ||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||    
10827043 aaagtgtcgatgctatatagattagataaaatctaagatagattattgttggtttttggttaattgatcttgtgattcattttgttgattggtaattata 10826944  T
272 taatgcaggtggagttctggatagat 297  Q
    ||||||||||||||||||||||||||    
10826943 taatgcaggtggagttctggatagat 10826918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University